Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-365a-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
RP11-295P9.6
hsa-miR-365a-5p
IP

Gene Details
Chromosome: 10
Transcript: ENST00000412388
Biotype: antisense
Gene id: ENSG00000225112
Gene Name: RP11-295P9.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-365a-5p
Sequence: agggacuuuugggggcagaugug
MirBase ID: MIMAT0009199
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCL35
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:13710498-13710526
exon
PAR-CLIP
DIRECT
LncBasev2
10:13710498-13710526
exon
PAR-CLIP
DIRECT
LncBasev2
10:13710498-13710526
exon
PAR-CLIP
DIRECT
LncBasev2
10:13710498-13710526
exon
PAR-CLIP
DIRECT
LncBasev2
RP11-383J24.6
hsa-miR-365a-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000607837
Biotype: lincRNA
Gene id: ENSG00000271975
Gene Name: RP11-383J24.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-365a-5p
Sequence: agggacuuuugggggcagaugug
MirBase ID: MIMAT0009199
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: EF3DAGO2
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:124307945-124307973
exon
PAR-CLIP
DIRECT
LncBasev2
RP4-740C4.7
hsa-miR-365a-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000607858
Biotype: sense_intronic
Gene id: ENSG00000272420
Gene Name: RP4-740C4.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-365a-5p
Sequence: agggacuuuugggggcagaugug
MirBase ID: MIMAT0009199
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: EF3DAGO2
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:2363184-2363212
exon
PAR-CLIP
DIRECT
LncBasev2
Funded by: