Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-365b-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC004158.3
hsa-miR-365b-3p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000564508
Biotype: lincRNA
Gene id: ENSG00000260664
Gene Name: AC004158.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-365b-3p
Sequence: uaaugccccuaaaaauccuuau
MirBase ID: MIMAT0022834
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:72428069-72428097
exon
HITS-CLIP
DIRECT
LncBasev2
AC004987.9
hsa-miR-365b-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000395959
Biotype: processed_pseudogene
Gene id: ENSG00000233225
Gene Name: AC004987.9
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-365b-3p
Sequence: uaaugccccuaaaaauccuuau
MirBase ID: MIMAT0022834
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:39834586-39834614
exon
HITS-CLIP
DIRECT
LncBasev2
AC005481.5
hsa-miR-365b-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000409610
Biotype: antisense
Gene id: ENSG00000222012
Gene Name: AC005481.5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-365b-3p
Sequence: uaaugccccuaaaaauccuuau
MirBase ID: MIMAT0022834
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
7:157618187-157618215
exon
HITS-CLIP
DIRECT
LncBasev2
AC007246.3
hsa-miR-365b-3p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000449569
Biotype: antisense
Gene id: ENSG00000231312
Gene Name: AC007246.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-365b-3p
Sequence: uaaugccccuaaaaauccuuau
MirBase ID: MIMAT0022834
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:39599704-39599732
exon
HITS-CLIP
DIRECT
LncBasev2
AC013394.2
hsa-miR-365b-3p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000557682
Biotype: lincRNA
Gene id: ENSG00000272888
Gene Name: AC013394.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-365b-3p
Sequence: uaaugccccuaaaaauccuuau
MirBase ID: MIMAT0022834
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:92898816-92898844
exon
HITS-CLIP
DIRECT
LncBasev2
AC013394.2
hsa-miR-365b-3p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000554133
Biotype: retained_intron
Gene id: ENSG00000272888
Gene Name: AC013394.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-365b-3p
Sequence: uaaugccccuaaaaauccuuau
MirBase ID: MIMAT0022834
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:92884593-92884621
exon
HITS-CLIP
DIRECT
LncBasev2
AC093323.3
hsa-miR-365b-3p
IP

Gene Details
Chromosome: 4
Transcript: ENST00000307533
Biotype: lincRNA
Gene id: ENSG00000170846
Gene Name: AC093323.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-365b-3p
Sequence: uaaugccccuaaaaauccuuau
MirBase ID: MIMAT0022834
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
4:6675129-6675157
exon
HITS-CLIP
DIRECT
LncBasev2
AC144833.1
hsa-miR-365b-3p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000567953
Biotype: sense_intronic
Gene id: ENSG00000261426
Gene Name: AC144833.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-365b-3p
Sequence: uaaugccccuaaaaauccuuau
MirBase ID: MIMAT0022834
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:27363680-27363708
exon
HITS-CLIP
DIRECT
LncBasev2
AKT3-IT1
hsa-miR-365b-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000417120
Biotype: sense_intronic
Gene id: ENSG00000228939
Gene Name: AKT3-IT1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-365b-3p
Sequence: uaaugccccuaaaaauccuuau
MirBase ID: MIMAT0022834
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:243794393-243794421
exon
HITS-CLIP
DIRECT
LncBasev2
C14orf132
hsa-miR-365b-3p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000555004
Biotype: lincRNA
Gene id: ENSG00000227051
Gene Name: C14orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-365b-3p
Sequence: uaaugccccuaaaaauccuuau
MirBase ID: MIMAT0022834
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:96093193-96093221
exon
HITS-CLIP
DIRECT
LncBasev2
CASC15
hsa-miR-365b-3p
IP

Gene Details
Chromosome: 6
Transcript: ENST00000606197
Biotype: lincRNA
Gene id: ENSG00000272168
Gene Name: CASC15
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-365b-3p
Sequence: uaaugccccuaaaaauccuuau
MirBase ID: MIMAT0022834
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:22195073-22195101
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-365b-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-365b-3p
Sequence: uaaugccccuaaaaauccuuau
MirBase ID: MIMAT0022834
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140527871-140527899
exon
HITS-CLIP
DIRECT
LncBasev2
CEBPZ-AS1
hsa-miR-365b-3p
IP

Gene Details
Chromosome: 2
Transcript: NR_037879.1
Biotype: sense
Gene id: NR_037879.1 (gene)
Gene Name: CEBPZ-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-365b-3p
Sequence: uaaugccccuaaaaauccuuau
MirBase ID: MIMAT0022834
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:37203944-37203972
exon
HITS-CLIP
DIRECT
LncBasev2
CENPBD1P1
hsa-miR-365b-3p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000493504
Biotype: processed_transcript
Gene id: ENSG00000213753
Gene Name: CENPBD1P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-365b-3p
Sequence: uaaugccccuaaaaauccuuau
MirBase ID: MIMAT0022834
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: EF3DAGO2
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:58582675-58582703
exon
PAR-CLIP
DIRECT
LncBasev2
19:58582675-58582703
exon
PAR-CLIP
DIRECT
LncBasev2
CTD-3064H18.1
hsa-miR-365b-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000585890
Biotype: antisense
Gene id: ENSG00000266916
Gene Name: CTD-3064H18.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary

miRNA Details
Name: hsa-miR-365b-3p
Sequence: uaaugccccuaaaaauccuuau
MirBase ID: MIMAT0022834
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:37497253-37497281
exon
HITS-CLIP
DIRECT
LncBasev2
DGCR5
hsa-miR-365b-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000438934
Biotype: antisense
Gene id: ENSG00000237517
Gene Name: DGCR5
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-365b-3p
Sequence: uaaugccccuaaaaauccuuau
MirBase ID: MIMAT0022834
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:18993550-18993578
exon
HITS-CLIP
DIRECT
LncBasev2
DGCR5
hsa-miR-365b-3p
IP

Gene Details
Chromosome: 22
Transcript: NR_002733.2
Biotype: lincRNA
Gene id: NR_002733.2 (gene)
Gene Name: DGCR5
UCSC graphic: -
Expression:
  Cell Line Tissue Category
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-365b-3p
Sequence: uaaugccccuaaaaauccuuau
MirBase ID: MIMAT0022834
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:18993550-18993578
exon
HITS-CLIP
DIRECT
LncBasev2
DLX6-AS1
hsa-miR-365b-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000430027
Biotype: antisense
Gene id: ENSG00000231764
Gene Name: DLX6-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-365b-3p
Sequence: uaaugccccuaaaaauccuuau
MirBase ID: MIMAT0022834
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:96956567-96956595
exon
HITS-CLIP
DIRECT
LncBasev2
7:96961617-96961645
exon
HITS-CLIP
DIRECT
LncBasev2
DNAJC3-AS1
hsa-miR-365b-3p
IP

Gene Details
Chromosome: 13
Transcript: ENST00000499499
Biotype: lincRNA
Gene id: ENSG00000247400
Gene Name: DNAJC3-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-365b-3p
Sequence: uaaugccccuaaaaauccuuau
MirBase ID: MIMAT0022834
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
13:95676216-95676244
exon
HITS-CLIP
DIRECT
LncBasev2
EGFEM1P
hsa-miR-365b-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000431685
Biotype: unitary_pseudogene
Gene id: ENSG00000206120
Gene Name: EGFEM1P
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-365b-3p
Sequence: uaaugccccuaaaaauccuuau
MirBase ID: MIMAT0022834
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:168309343-168309371
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: