Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-372-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
HULC
hsa-miR-372-3p
-
RP qP

Gene Details
Chromosome: 6
Transcript: ENST00000503668
Biotype: lincRNA
Gene id: ENSG00000251164
Gene Name: HULC
UCSC graphic:
Expression:
  Cell Line Tissue Category
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-372-3p
Sequence: aaagugcugcgacauuugagcgu
MirBase ID: MIMAT0000724
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HEP3B
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
-
exon
Luciferase Reporter Assay
DIRECT
LncBasev2
-
exon
qPCR
INDIRECT
LncBasev2
Funded by: