Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-375

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC005884.1
hsa-miR-375
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000437246
Biotype: processed_pseudogene
Gene id: ENSG00000227694
Gene Name: AC005884.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:61070298-61070326
exon
HITS-CLIP
DIRECT
LncBasev2
AC007238.1
hsa-miR-375
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000434096
Biotype: processed_pseudogene
Gene id: ENSG00000231043
Gene Name: AC007238.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:58460473-58460501
exon
HITS-CLIP
DIRECT
LncBasev2
AC009362.2
hsa-miR-375
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000427253
Biotype: processed_pseudogene
Gene id: ENSG00000233287
Gene Name: AC009362.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:131242947-131242975
exon
HITS-CLIP
DIRECT
LncBasev2
AC013394.2
hsa-miR-375
IP

Gene Details
Chromosome: 15
Transcript: ENST00000557682
Biotype: lincRNA
Gene id: ENSG00000272888
Gene Name: AC013394.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:92885535-92885563
exon
HITS-CLIP
DIRECT
LncBasev2
AC017116.11
hsa-miR-375
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000445938
Biotype: sense_overlapping
Gene id: ENSG00000239775
Gene Name: AC017116.11
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary

miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:44064888-44064916
exon
HITS-CLIP
DIRECT
LncBasev2
AC083843.1
hsa-miR-375
IP

Gene Details
Chromosome: 8
Transcript: ENST00000568248
Biotype: lincRNA
Gene id: ENSG00000259820
Gene Name: AC083843.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:134794901-134794929
exon
HITS-CLIP
DIRECT
LncBasev2
AC091633.2
hsa-miR-375
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000454858
Biotype: processed_pseudogene
Gene id: ENSG00000236844
Gene Name: AC091633.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:195554902-195554930
exon
HITS-CLIP
DIRECT
LncBasev2
AC092155.1
hsa-miR-375
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000454675
Biotype: processed_pseudogene
Gene id: ENSG00000229503
Gene Name: AC092155.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:62532823-62532855
exon
HITS-CLIP
DIRECT
LncBasev2
AP000347.2
hsa-miR-375
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000417194
Biotype: processed_transcript
Gene id: ENSG00000272578
Gene Name: AP000347.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
22:23691175-23691203
exon
HITS-CLIP
DIRECT
LncBasev2
AP000350.6
hsa-miR-375
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000439492
Biotype: processed_pseudogene
Gene id: ENSG00000225282
Gene Name: AP000350.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:23928107-23928135
exon
HITS-CLIP
DIRECT
LncBasev2
API5P1
hsa-miR-375
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000424316
Biotype: processed_pseudogene
Gene id: ENSG00000234558
Gene Name: API5P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:116107976-116108004
exon
HITS-CLIP
DIRECT
LncBasev2
ARRDC3-AS1
hsa-miR-375
IP

Gene Details
Chromosome: 5
Transcript: NR_027435.1
Biotype: antisense
Gene id: NR_027435.1 (gene)
Gene Name: ARRDC3-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:91380597-91380625
exon
HITS-CLIP
DIRECT
LncBasev2
ATP5A1P2
hsa-miR-375
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000616464
Biotype: processed_transcript
Gene id: ENSG00000227682
Gene Name: ATP5A1P2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:155269668-155269696
exon
HITS-CLIP
DIRECT
LncBasev2
BNIP3P26
hsa-miR-375
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000600827
Biotype: processed_pseudogene
Gene id: ENSG00000268705
Gene Name: BNIP3P26
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
19:21521619-21521647
exon
HITS-CLIP
DIRECT
LncBasev2
C14orf132
hsa-miR-375
IP

Gene Details
Chromosome: 14
Transcript: ENST00000553782
Biotype: lincRNA
Gene id: ENSG00000227051
Gene Name: C14orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:96040252-96040280
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-375
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
MCF7
IP
Tested Cell Line: MCF7
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140526043-140526071
exon
HITS-CLIP
DIRECT
LncBasev2
CATSPER2P1
hsa-miR-375
-
IP

Gene Details
Chromosome: 15
Transcript: ENST00000381680
Biotype: processed_transcript
Gene id: ENSG00000205771
Gene Name: CATSPER2P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
15:43736393-43736421
exon
HITS-CLIP
DIRECT
LncBasev2
CBR3-AS1
hsa-miR-375
IP

Gene Details
Chromosome: 21
Transcript: ENST00000413862
Biotype: antisense
Gene id: ENSG00000236830
Gene Name: CBR3-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
MCF7
IP
Tested Cell Line: MCF7
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
21:36132659-36132687
exon
HITS-CLIP
DIRECT
LncBasev2
CDC42P1
hsa-miR-375
-
IP

Gene Details
Chromosome: 20
Transcript: ENST00000456658
Biotype: processed_pseudogene
Gene id: ENSG00000234933
Gene Name: CDC42P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:34402324-34402352
exon
HITS-CLIP
DIRECT
LncBasev2
CDC42P5
hsa-miR-375
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000518654
Biotype: processed_pseudogene
Gene id: ENSG00000253439
Gene Name: CDC42P5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:173085828-173085856
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: