Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-378i

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC005562.1
hsa-miR-378i
IP

Gene Details
Chromosome: 17
Transcript: ENST00000440026
Biotype: processed_transcript
Gene id: ENSG00000214719
Gene Name: AC005562.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-378i
Sequence: acuggacuaggagucagaagg
MirBase ID: MIMAT0019074
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:30608506-30608534
exon
HITS-CLIP
DIRECT
LncBasev2
AC007238.1
hsa-miR-378i
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000434096
Biotype: processed_pseudogene
Gene id: ENSG00000231043
Gene Name: AC007238.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-378i
Sequence: acuggacuaggagucagaagg
MirBase ID: MIMAT0019074
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:58460442-58460470
exon
HITS-CLIP
DIRECT
LncBasev2
AC009948.5
hsa-miR-378i
IP

Gene Details
Chromosome: 2
Transcript: ENST00000442036
Biotype: antisense
Gene id: ENSG00000223960
Gene Name: AC009948.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-378i
Sequence: acuggacuaggagucagaagg
MirBase ID: MIMAT0019074
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
2:178418666-178418694
exon
HITS-CLIP
DIRECT
LncBasev2
AC010226.4
hsa-miR-378i
IP

Gene Details
Chromosome: 5
Transcript: ENST00000506485
Biotype: antisense
Gene id: ENSG00000249249
Gene Name: AC010226.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-378i
Sequence: acuggacuaggagucagaagg
MirBase ID: MIMAT0019074
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
5:115602431-115602459
exon
HITS-CLIP
DIRECT
LncBasev2
AC010226.4
hsa-miR-378i
IP

Gene Details
Chromosome: 5
Transcript: NR_109874.1
Biotype: antisense
Gene id: NR_109874.1 (gene)
Gene Name: AC010226.4
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-378i
Sequence: acuggacuaggagucagaagg
MirBase ID: MIMAT0019074
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
5:115602431-115602459
exon
HITS-CLIP
DIRECT
LncBasev2
AC135048.13
hsa-miR-378i
IP

Gene Details
Chromosome: 16
Transcript: ENST00000566056
Biotype: processed_transcript
Gene id: ENSG00000261487
Gene Name: AC135048.13
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-378i
Sequence: acuggacuaggagucagaagg
MirBase ID: MIMAT0019074
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
16:30953548-30953576
exon
HITS-CLIP
DIRECT
LncBasev2
AP000347.2
hsa-miR-378i
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000417194
Biotype: processed_transcript
Gene id: ENSG00000272578
Gene Name: AP000347.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-378i
Sequence: acuggacuaggagucagaagg
MirBase ID: MIMAT0019074
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
22:23658157-23658185
exon
HITS-CLIP
DIRECT
LncBasev2
C1orf132
hsa-miR-378i
IP

Gene Details
Chromosome: 1
Transcript: ENST00000608023
Biotype: lincRNA
Gene id: ENSG00000203709
Gene Name: C1orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-378i
Sequence: acuggacuaggagucagaagg
MirBase ID: MIMAT0019074
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
1:207810511-207810539
exon
HITS-CLIP
DIRECT
LncBasev2
CENPUP2
hsa-miR-378i
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000555897
Biotype: processed_pseudogene
Gene id: ENSG00000258546
Gene Name: CENPUP2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-378i
Sequence: acuggacuaggagucagaagg
MirBase ID: MIMAT0019074
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBACD3
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:25092943-25092971
exon
PAR-CLIP
DIRECT
LncBasev2
CROCCP1
hsa-miR-378i
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000426910
Biotype: processed_pseudogene
Gene id: ENSG00000225769
Gene Name: CROCCP1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-378i
Sequence: acuggacuaggagucagaagg
MirBase ID: MIMAT0019074
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
X:135433377-135433405
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-52I2.4
hsa-miR-378i
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000621646
Biotype: processed_transcript
Gene id: ENSG00000273654
Gene Name: CTB-52I2.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-378i
Sequence: acuggacuaggagucagaagg
MirBase ID: MIMAT0019074
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
19:18031831-18031859
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-378i
IP

Gene Details
Chromosome: 5
Transcript: ENST00000534918
Biotype: retained_intron
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-378i
Sequence: acuggacuaggagucagaagg
MirBase ID: MIMAT0019074
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:478813-478841
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2366F13.1
hsa-miR-378i
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499459
Biotype: antisense
Gene id: ENSG00000247796
Gene Name: CTD-2366F13.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-378i
Sequence: acuggacuaggagucagaagg
MirBase ID: MIMAT0019074
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:53112942-53112970
exon
HITS-CLIP
DIRECT
LncBasev2
EI24P4
hsa-miR-378i
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000423683
Biotype: processed_pseudogene
Gene id: ENSG00000236343
Gene Name: EI24P4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-378i
Sequence: acuggacuaggagucagaagg
MirBase ID: MIMAT0019074
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:145005334-145005362
exon
PAR-CLIP
DIRECT
LncBasev2
GAS5
hsa-miR-378i
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000421068
Biotype: retained_intron
Gene id: ENSG00000234741
Gene Name: GAS5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-378i
Sequence: acuggacuaggagucagaagg
MirBase ID: MIMAT0019074
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:173866343-173866371
exon
HITS-CLIP
DIRECT
LncBasev2
GAS5
hsa-miR-378i
IP

Gene Details
Chromosome: 1
Transcript: ENST00000431268
Biotype: retained_intron
Gene id: ENSG00000234741
Gene Name: GAS5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-378i
Sequence: acuggacuaggagucagaagg
MirBase ID: MIMAT0019074
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
1:173864880-173864908
exon
HITS-CLIP
DIRECT
LncBasev2
1:173864880-173864908
exon
HITS-CLIP
DIRECT
LncBasev2
1:173864880-173864908
exon
HITS-CLIP
DIRECT
LncBasev2
GEMIN8P4
hsa-miR-378i
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000380526
Biotype: processed_pseudogene
Gene id: ENSG00000228175
Gene Name: GEMIN8P4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-378i
Sequence: acuggacuaggagucagaagg
MirBase ID: MIMAT0019074
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:89994263-89994291
exon
PAR-CLIP
DIRECT
LncBasev2
1:89994263-89994291
exon
PAR-CLIP
DIRECT
LncBasev2
GMFBP1
hsa-miR-378i
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000467831
Biotype: processed_pseudogene
Gene id: ENSG00000243495
Gene Name: GMFBP1
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-378i
Sequence: acuggacuaggagucagaagg
MirBase ID: MIMAT0019074
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:100665203-100665231
exon
PAR-CLIP
DIRECT
LncBasev2
HNRNPH3P1
hsa-miR-378i
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000431935
Biotype: processed_pseudogene
Gene id: ENSG00000230247
Gene Name: HNRNPH3P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-378i
Sequence: acuggacuaggagucagaagg
MirBase ID: MIMAT0019074
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:80529230-80529258
exon
PAR-CLIP
DIRECT
LncBasev2
INO80B-WBP1
hsa-miR-378i
IP

Gene Details
Chromosome: 2
Transcript: NR_037849.1
Biotype: sense
Gene id: NR_037849.1 (gene)
Gene Name: INO80B-WBP1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-378i
Sequence: acuggacuaggagucagaagg
MirBase ID: MIMAT0019074
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:74460302-74460330
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: