Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-423-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC008753.3
hsa-miR-423-3p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000423096
Biotype: processed_pseudogene
Gene id: ENSG00000238150
Gene Name: AC008753.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-423-3p
Sequence: agcucggucugaggccccucagu
MirBase ID: MIMAT0001340
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
19:53775590-53775618
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:53775590-53775618
exon
HITS-CLIP
DIRECT
LncBasev2
ACTBP9
hsa-miR-423-3p
-
IP

Gene Details
Chromosome: 18
Transcript: ENST00000587663
Biotype: processed_pseudogene
Gene id: ENSG00000266920
Gene Name: ACTBP9
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-423-3p
Sequence: agcucggucugaggccccucagu
MirBase ID: MIMAT0001340
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
18:62442569-62442597
exon
HITS-CLIP
DIRECT
LncBasev2
ACTG1P14
hsa-miR-423-3p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000446382
Biotype: processed_pseudogene
Gene id: ENSG00000230581
Gene Name: ACTG1P14
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-423-3p
Sequence: agcucggucugaggccccucagu
MirBase ID: MIMAT0001340
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:6835009-6835037
exon
HITS-CLIP
DIRECT
LncBasev2
AP006621.5
hsa-miR-423-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000530083
Biotype: lincRNA
Gene id: ENSG00000255284
Gene Name: AP006621.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-423-3p
Sequence: agcucggucugaggccccucagu
MirBase ID: MIMAT0001340
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
11:777651-777679
exon
HITS-CLIP
DIRECT
LncBasev2
CLUHP3
hsa-miR-423-3p
-
IP

Gene Details
Chromosome: 16
Transcript: ENST00000562354
Biotype: processed_transcript
Gene id: ENSG00000131797
Gene Name: CLUHP3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-423-3p
Sequence: agcucggucugaggccccucagu
MirBase ID: MIMAT0001340
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:31708805-31708833
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-273B12.8
hsa-miR-423-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000427476
Biotype: lincRNA
Gene id: ENSG00000269751
Gene Name: CTC-273B12.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-423-3p
Sequence: agcucggucugaggccccucagu
MirBase ID: MIMAT0001340
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
19:48480177-48480205
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-308K20.1
hsa-miR-423-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000520067
Biotype: antisense
Gene id: ENSG00000204758
Gene Name: CTC-308K20.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-423-3p
Sequence: agcucggucugaggccccucagu
MirBase ID: MIMAT0001340
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
5:172958745-172958773
exon
HITS-CLIP
DIRECT
LncBasev2
5:172958745-172958773
exon
HITS-CLIP
DIRECT
LncBasev2
5:172958745-172958773
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-451P13.1
hsa-miR-423-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000474167
Biotype: processed_pseudogene
Gene id: ENSG00000213757
Gene Name: CTC-451P13.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-423-3p
Sequence: agcucggucugaggccccucagu
MirBase ID: MIMAT0001340
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:79284168-79284196
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-423-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000534918
Biotype: retained_intron
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-423-3p
Sequence: agcucggucugaggccccucagu
MirBase ID: MIMAT0001340
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:478416-478444
exon
HITS-CLIP
DIRECT
LncBasev2
5:478416-478444
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2587H24.14
hsa-miR-423-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000586923
Biotype: retained_intron
Gene id: ENSG00000276570
Gene Name: CTD-2587H24.14
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-423-3p
Sequence: agcucggucugaggccccucagu
MirBase ID: MIMAT0001340
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:55229823-55229851
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P8
hsa-miR-423-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000419025
Biotype: processed_pseudogene
Gene id: ENSG00000223529
Gene Name: EEF1A1P8
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-423-3p
Sequence: agcucggucugaggccccucagu
MirBase ID: MIMAT0001340
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:184027420-184027448
exon
HITS-CLIP
DIRECT
LncBasev2
ERHP1
hsa-miR-423-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000523006
Biotype: processed_pseudogene
Gene id: ENSG00000254270
Gene Name: ERHP1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-423-3p
Sequence: agcucggucugaggccccucagu
MirBase ID: MIMAT0001340
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:139534433-139534461
exon
HITS-CLIP
DIRECT
LncBasev2
FAM115B
hsa-miR-423-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000414990
Biotype: unprocessed_pseudogene
Gene id: ENSG00000223459
Gene Name: FAM115B
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-423-3p
Sequence: agcucggucugaggccccucagu
MirBase ID: MIMAT0001340
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:143598310-143598338
exon
HITS-CLIP
DIRECT
LncBasev2
FLJ37453
hsa-miR-423-3p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000317122
Biotype: antisense
Gene id: ENSG00000179743
Gene Name: FLJ37453
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-423-3p
Sequence: agcucggucugaggccccucagu
MirBase ID: MIMAT0001340
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:15835005-15835033
exon
HITS-CLIP
DIRECT
LncBasev2
HEIH
hsa-miR-423-3p
-
IP

Gene Details
Chromosome: 5
Transcript: NR_045680.1
Biotype: lincRNA
Gene id: NR_045680.1 (gene)
Gene Name: HEIH
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-423-3p
Sequence: agcucggucugaggccccucagu
MirBase ID: MIMAT0001340
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: TZMBL
Category: Cancer/Malignant
Experimental Condition: shRNs against HIV-1
Location
Region
Method
Result
Validation Type
Source
5:180830853-180830881
exon
HITS-CLIP
DIRECT
LncBasev2
HNRNPKP4
hsa-miR-423-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000485383
Biotype: processed_pseudogene
Gene id: ENSG00000243547
Gene Name: HNRNPKP4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-423-3p
Sequence: agcucggucugaggccccucagu
MirBase ID: MIMAT0001340
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:96349782-96349810
exon
HITS-CLIP
DIRECT
LncBasev2
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
3:96349782-96349810
exon
HITS-CLIP
DIRECT
LncBasev2
HNRNPUL2-BSCL2
hsa-miR-423-3p
IP

Gene Details
Chromosome: 11
Transcript: NR_037946.1
Biotype: sense
Gene id: NR_037946.1 (gene)
Gene Name: HNRNPUL2-BSCL2
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-423-3p
Sequence: agcucggucugaggccccucagu
MirBase ID: MIMAT0001340
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:62724326-62724354
exon
HITS-CLIP
DIRECT
LncBasev2
HOXA10-HOXA9
hsa-miR-423-3p
IP

Gene Details
Chromosome: 7
Transcript: NR_037940.1
Biotype: sense
Gene id: NR_037940.1 (gene)
Gene Name: HOXA10-HOXA9
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-miR-423-3p
Sequence: agcucggucugaggccccucagu
MirBase ID: MIMAT0001340
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
7:27163615-27163643
exon
HITS-CLIP
DIRECT
LncBasev2
INMT-FAM188B
hsa-miR-423-3p
IP

Gene Details
Chromosome: 7
Transcript: NR_037598.1
Biotype: sense
Gene id: NR_037598.1 (gene)
Gene Name: INMT-FAM188B
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-miR-423-3p
Sequence: agcucggucugaggccccucagu
MirBase ID: MIMAT0001340
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30882950-30882978
exon
HITS-CLIP
DIRECT
LncBasev2
KRT8P3
hsa-miR-423-3p
-
IP

Gene Details
Chromosome: 8
Transcript: ENST00000519669
Biotype: processed_pseudogene
Gene id: ENSG00000254285
Gene Name: KRT8P3
UCSC graphic:
Expression:
  Cell Line Tissue Category
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-423-3p
Sequence: agcucggucugaggccccucagu
MirBase ID: MIMAT0001340
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:61579210-61579238
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: