Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-423-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
A1BG-AS1
hsa-miR-423-5p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000594950
Biotype: antisense
Gene id: ENSG00000268895
Gene Name: A1BG-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-423-5p
Sequence: ugaggggcagagagcgagacuuu
MirBase ID: MIMAT0004748
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
19:58354123-58354151
exon
HITS-CLIP
DIRECT
LncBasev2
AC006538.8
hsa-miR-423-5p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000612495
Biotype: sense_intronic
Gene id: ENSG00000276097
Gene Name: AC006538.8
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-423-5p
Sequence: ugaggggcagagagcgagacuuu
MirBase ID: MIMAT0004748
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
19:2701245-2701273
exon
HITS-CLIP
DIRECT
LncBasev2
AC007036.5
hsa-miR-423-5p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000511893
Biotype: sense_overlapping
Gene id: ENSG00000251660
Gene Name: AC007036.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-423-5p
Sequence: ugaggggcagagagcgagacuuu
MirBase ID: MIMAT0004748
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:30157586-30157614
exon
HITS-CLIP
DIRECT
LncBasev2
AC009948.5
hsa-miR-423-5p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000436616
Biotype: antisense
Gene id: ENSG00000223960
Gene Name: AC009948.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-423-5p
Sequence: ugaggggcagagagcgagacuuu
MirBase ID: MIMAT0004748
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:178434026-178434054
exon
PAR-CLIP
DIRECT
LncBasev2
AC092155.1
hsa-miR-423-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000454675
Biotype: processed_pseudogene
Gene id: ENSG00000229503
Gene Name: AC092155.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-423-5p
Sequence: ugaggggcagagagcgagacuuu
MirBase ID: MIMAT0004748
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:62532898-62532926
exon
HITS-CLIP
DIRECT
LncBasev2
AC092566.1
hsa-miR-423-5p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000570582
Biotype: processed_pseudogene
Gene id: ENSG00000261866
Gene Name: AC092566.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-423-5p
Sequence: ugaggggcagagagcgagacuuu
MirBase ID: MIMAT0004748
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
19:8676821-8676849
exon
HITS-CLIP
DIRECT
LncBasev2
AC103564.6
hsa-miR-423-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000432853
Biotype: unprocessed_pseudogene
Gene id: ENSG00000232760
Gene Name: AC103564.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-423-5p
Sequence: ugaggggcagagagcgagacuuu
MirBase ID: MIMAT0004748
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:131836118-131836146
exon
HITS-CLIP
DIRECT
LncBasev2
2:131836148-131836176
exon
HITS-CLIP
DIRECT
LncBasev2
AC135048.13
hsa-miR-423-5p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000566056
Biotype: processed_transcript
Gene id: ENSG00000261487
Gene Name: AC135048.13
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-423-5p
Sequence: ugaggggcagagagcgagacuuu
MirBase ID: MIMAT0004748
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
16:30948475-30948503
exon
HITS-CLIP
DIRECT
LncBasev2
AC135048.13
hsa-miR-423-5p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000562642
Biotype: processed_transcript
Gene id: ENSG00000261487
Gene Name: AC135048.13
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-423-5p
Sequence: ugaggggcagagagcgagacuuu
MirBase ID: MIMAT0004748
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:30956382-30956410
exon
PAR-CLIP
DIRECT
LncBasev2
AL133493.2
hsa-miR-423-5p
IP

Gene Details
Chromosome: 21
Transcript: ENST00000441095
Biotype: lincRNA
Gene id: ENSG00000233922
Gene Name: AL133493.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HepG2 Liver Cancer/Malignant
- Ovary Normal/Primary
- Testes Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-423-5p
Sequence: ugaggggcagagagcgagacuuu
MirBase ID: MIMAT0004748
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
21:45599579-45599607
exon
HITS-CLIP
DIRECT
LncBasev2
AP000347.2
hsa-miR-423-5p
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000417194
Biotype: processed_transcript
Gene id: ENSG00000272578
Gene Name: AP000347.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-423-5p
Sequence: ugaggggcagagagcgagacuuu
MirBase ID: MIMAT0004748
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
22:23691885-23691913
exon
HITS-CLIP
DIRECT
LncBasev2
22:23691343-23691371
exon
HITS-CLIP
DIRECT
LncBasev2
ARRDC1-AS1
hsa-miR-423-5p
IP

Gene Details
Chromosome: 9
Transcript: ENST00000623970
Biotype: antisense
Gene id: ENSG00000203993
Gene Name: ARRDC1-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-423-5p
Sequence: ugaggggcagagagcgagacuuu
MirBase ID: MIMAT0004748
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
9:137615734-137615762
exon
HITS-CLIP
DIRECT
LncBasev2
ASH1L-AS1
hsa-miR-423-5p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000452809
Biotype: antisense
Gene id: ENSG00000235919
Gene Name: ASH1L-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-423-5p
Sequence: ugaggggcagagagcgagacuuu
MirBase ID: MIMAT0004748
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
1:155563888-155563916
exon
HITS-CLIP
DIRECT
LncBasev2
ASH1L-AS1
hsa-miR-423-5p
IP

Gene Details
Chromosome: 1
Transcript: NR_027023.1
Biotype: antisense
Gene id: NR_027023.1 (gene)
Gene Name: ASH1L-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-423-5p
Sequence: ugaggggcagagagcgagacuuu
MirBase ID: MIMAT0004748
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
1:155563888-155563916
exon
HITS-CLIP
DIRECT
LncBasev2
ATP5F1P1
hsa-miR-423-5p
-
IP

Gene Details
Chromosome: 13
Transcript: ENST00000433775
Biotype: processed_pseudogene
Gene id: ENSG00000224451
Gene Name: ATP5F1P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-423-5p
Sequence: ugaggggcagagagcgagacuuu
MirBase ID: MIMAT0004748
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
13:51598520-51598548
exon
HITS-CLIP
DIRECT
LncBasev2
ATP5HP2
hsa-miR-423-5p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000433885
Biotype: processed_pseudogene
Gene id: ENSG00000229184
Gene Name: ATP5HP2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-423-5p
Sequence: ugaggggcagagagcgagacuuu
MirBase ID: MIMAT0004748
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
9:2900690-2900718
exon
HITS-CLIP
DIRECT
LncBasev2
ATP6V0CP3
hsa-miR-423-5p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000417255
Biotype: processed_pseudogene
Gene id: ENSG00000213435
Gene Name: ATP6V0CP3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-423-5p
Sequence: ugaggggcagagagcgagacuuu
MirBase ID: MIMAT0004748
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
6:42727679-42727707
exon
HITS-CLIP
DIRECT
LncBasev2
BRD2-IT1
hsa-miR-423-5p
IP

Gene Details
Chromosome: 6
Transcript: ENST00000415875
Biotype: sense_intronic
Gene id: ENSG00000223837
Gene Name: BRD2-IT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-423-5p
Sequence: ugaggggcagagagcgagacuuu
MirBase ID: MIMAT0004748
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
6:32970823-32970851
exon
HITS-CLIP
DIRECT
LncBasev2
BZW1P2
hsa-miR-423-5p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000473537
Biotype: processed_pseudogene
Gene id: ENSG00000198406
Gene Name: BZW1P2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-423-5p
Sequence: ugaggggcagagagcgagacuuu
MirBase ID: MIMAT0004748
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:116645877-116645905
exon
HITS-CLIP
DIRECT
LncBasev2
C1orf132
hsa-miR-423-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000608023
Biotype: lincRNA
Gene id: ENSG00000203709
Gene Name: C1orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-423-5p
Sequence: ugaggggcagagagcgagacuuu
MirBase ID: MIMAT0004748
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:207808568-207808596
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
1:207807884-207807912
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: