Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-4452

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC078899.1
hsa-miR-4452
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000521432
Biotype: processed_pseudogene
Gene id: ENSG00000213985
Gene Name: AC078899.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-4452
Sequence: uugaauucuuggccuuaagugau
MirBase ID: MIMAT0018974
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:20259066-20259094
exon
HITS-CLIP
DIRECT
LncBasev2
AP000350.6
hsa-miR-4452
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000439492
Biotype: processed_pseudogene
Gene id: ENSG00000225282
Gene Name: AP000350.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-4452
Sequence: uugaauucuuggccuuaagugau
MirBase ID: MIMAT0018974
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:23928103-23928131
exon
HITS-CLIP
DIRECT
LncBasev2
CHCHD3P3
hsa-miR-4452
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000446783
Biotype: processed_pseudogene
Gene id: ENSG00000214973
Gene Name: CHCHD3P3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-4452
Sequence: uugaauucuuggccuuaagugau
MirBase ID: MIMAT0018974
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:27201286-27201314
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2298J14.2
hsa-miR-4452
IP

Gene Details
Chromosome: 14
Transcript: ENST00000557067
Biotype: lincRNA
Gene id: ENSG00000258636
Gene Name: CTD-2298J14.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
HREpiC Kidney Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-4452
Sequence: uugaauucuuggccuuaagugau
MirBase ID: MIMAT0018974
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:41588064-41588092
exon
HITS-CLIP
DIRECT
LncBasev2
DAPK1-IT1
hsa-miR-4452
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000431813
Biotype: sense_intronic
Gene id: ENSG00000236709
Gene Name: DAPK1-IT1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-4452
Sequence: uugaauucuuggccuuaagugau
MirBase ID: MIMAT0018974
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:87554457-87554485
exon
HITS-CLIP
DIRECT
LncBasev2
EIF1P3
hsa-miR-4452
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000423841
Biotype: processed_pseudogene
Gene id: ENSG00000231684
Gene Name: EIF1P3
UCSC graphic:
Expression:
  Cell Line Tissue Category
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-4452
Sequence: uugaauucuuggccuuaagugau
MirBase ID: MIMAT0018974
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:182336081-182336109
exon
HITS-CLIP
DIRECT
LncBasev2
EIF1P7
hsa-miR-4452
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000487533
Biotype: processed_pseudogene
Gene id: ENSG00000213772
Gene Name: EIF1P7
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-4452
Sequence: uugaauucuuggccuuaagugau
MirBase ID: MIMAT0018974
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:9271521-9271549
exon
HITS-CLIP
DIRECT
LncBasev2
FAM24B-CUZD1
hsa-miR-4452
IP

Gene Details
Chromosome: 10
Transcript: NR_037915.1
Biotype: sense
Gene id: NR_037915.1 (gene)
Gene Name: FAM24B-CUZD1
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-miR-4452
Sequence: uugaauucuuggccuuaagugau
MirBase ID: MIMAT0018974
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:122839060-122839088
exon
HITS-CLIP
DIRECT
LncBasev2
H19
hsa-miR-4452
IP

Gene Details
Chromosome: 11
Transcript: ENST00000414790
Biotype: lincRNA
Gene id: ENSG00000130600
Gene Name: H19
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-4452
Sequence: uugaauucuuggccuuaagugau
MirBase ID: MIMAT0018974
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:1995486-1995514
exon
HITS-CLIP
DIRECT
LncBasev2
HSP90AA6P
hsa-miR-4452
-
IP

Gene Details
Chromosome: 4
Transcript: ENST00000506634
Biotype: transcribed_processed_pseudogene
Gene id: ENSG00000181359
Gene Name: HSP90AA6P
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-4452
Sequence: uugaauucuuggccuuaagugau
MirBase ID: MIMAT0018974
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:170605315-170605343
exon
HITS-CLIP
DIRECT
LncBasev2
HSP90B3P
hsa-miR-4452
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000415545
Biotype: processed_pseudogene
Gene id: ENSG00000203914
Gene Name: HSP90B3P
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-4452
Sequence: uugaauucuuggccuuaagugau
MirBase ID: MIMAT0018974
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:91642604-91642632
exon
HITS-CLIP
DIRECT
LncBasev2
INTS6P1
hsa-miR-4452
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000504674
Biotype: processed_pseudogene
Gene id: ENSG00000250492
Gene Name: INTS6P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-4452
Sequence: uugaauucuuggccuuaagugau
MirBase ID: MIMAT0018974
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:39719020-39719048
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00476
hsa-miR-4452
IP

Gene Details
Chromosome: 9
Transcript: ENST00000427259
Biotype: processed_transcript
Gene id: ENSG00000175611
Gene Name: LINC00476
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-4452
Sequence: uugaauucuuggccuuaagugau
MirBase ID: MIMAT0018974
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:95869908-95869936
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00657
hsa-miR-4452
IP

Gene Details
Chromosome: 20
Transcript: ENST00000565493
Biotype: lincRNA
Gene id: ENSG00000260032
Gene Name: LINC00657
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-4452
Sequence: uugaauucuuggccuuaagugau
MirBase ID: MIMAT0018974
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:36048666-36048694
exon
HITS-CLIP
DIRECT
LncBasev2
MIR3916
hsa-miR-4452
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000421406
Biotype: transcribed_unprocessed_pseudogene
Gene id: ENSG00000227671
Gene Name: MIR3916
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-4452
Sequence: uugaauucuuggccuuaagugau
MirBase ID: MIMAT0018974
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:247190320-247190348
exon
HITS-CLIP
DIRECT
LncBasev2
1:247190236-247190264
exon
HITS-CLIP
DIRECT
LncBasev2
1:247190152-247190180
exon
HITS-CLIP
DIRECT
LncBasev2
MTATP6P1
hsa-miR-4452
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000514057
Biotype: unprocessed_pseudogene
Gene id: ENSG00000248527
Gene Name: MTATP6P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-4452
Sequence: uugaauucuuggccuuaagugau
MirBase ID: MIMAT0018974
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:634123-634151
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-4452
IP

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-4452
Sequence: uugaauucuuggccuuaagugau
MirBase ID: MIMAT0018974
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65429918-65429946
exon
HITS-CLIP
DIRECT
LncBasev2
OTUD6B-AS1
hsa-miR-4452
-
IP

Gene Details
Chromosome: 8
Transcript: ENST00000524003
Biotype: antisense
Gene id: ENSG00000253738
Gene Name: OTUD6B-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-4452
Sequence: uugaauucuuggccuuaagugau
MirBase ID: MIMAT0018974
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:91069386-91069414
exon
HITS-CLIP
DIRECT
LncBasev2
PABPC1P4
hsa-miR-4452
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000539977
Biotype: processed_pseudogene
Gene id: ENSG00000255642
Gene Name: PABPC1P4
UCSC graphic:
Expression:
  Cell Line Tissue Category
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-4452
Sequence: uugaauucuuggccuuaagugau
MirBase ID: MIMAT0018974
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:63823674-63823702
exon
HITS-CLIP
DIRECT
LncBasev2
RASA4CP
hsa-miR-4452
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000446874
Biotype: processed_transcript
Gene id: ENSG00000228903
Gene Name: RASA4CP
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-4452
Sequence: uugaauucuuggccuuaagugau
MirBase ID: MIMAT0018974
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:44027456-44027484
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: