Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-449a

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC005042.2
hsa-miR-449a
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000393397
Biotype: processed_pseudogene
Gene id: ENSG00000227331
Gene Name: AC005042.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-449a
Sequence: uggcaguguauuguuagcuggu
MirBase ID: MIMAT0001541
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
2:158548768-158548796
exon
HITS-CLIP
DIRECT
LncBasev2
AC058791.1
hsa-miR-449a
IP

Gene Details
Chromosome: 7
Transcript: NR_034120.1
Biotype: lincRNA
Gene id: NR_034120.1 (gene)
Gene Name: AC058791.1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-449a
Sequence: uggcaguguauuguuagcuggu
MirBase ID: MIMAT0001541
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:130913005-130913033
exon
HITS-CLIP
DIRECT
LncBasev2
AC078899.1
hsa-miR-449a
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000521432
Biotype: processed_pseudogene
Gene id: ENSG00000213985
Gene Name: AC078899.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-449a
Sequence: uggcaguguauuguuagcuggu
MirBase ID: MIMAT0001541
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:20258946-20258974
exon
HITS-CLIP
DIRECT
LncBasev2
AC105342.1
hsa-miR-449a
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000378334
Biotype: processed_pseudogene
Gene id: ENSG00000234429
Gene Name: AC105342.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-449a
Sequence: uggcaguguauuguuagcuggu
MirBase ID: MIMAT0001541
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
2:81197343-81197371
exon
HITS-CLIP
DIRECT
LncBasev2
ALDOAP2
hsa-miR-449a
-
IP

Gene Details
Chromosome: 10
Transcript: ENST00000398050
Biotype: processed_pseudogene
Gene id: ENSG00000214297
Gene Name: ALDOAP2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-449a
Sequence: uggcaguguauuguuagcuggu
MirBase ID: MIMAT0001541
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:125667827-125667855
exon
HITS-CLIP
DIRECT
LncBasev2
AP001062.7
hsa-miR-449a
IP

Gene Details
Chromosome: 21
Transcript: ENST00000448927
Biotype: antisense
Gene id: ENSG00000184441
Gene Name: AP001062.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-449a
Sequence: uggcaguguauuguuagcuggu
MirBase ID: MIMAT0001541
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
21:44331360-44331395
exon
HITS-CLIP
DIRECT
LncBasev2
AP001429.1
hsa-miR-449a
IP

Gene Details
Chromosome: 21
Transcript: ENST00000602568
Biotype: sense_intronic
Gene id: ENSG00000270116
Gene Name: AP001429.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-449a
Sequence: uggcaguguauuguuagcuggu
MirBase ID: MIMAT0001541
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
21:37101182-37101210
exon
HITS-CLIP
DIRECT
LncBasev2
AP006621.8
hsa-miR-449a
IP

Gene Details
Chromosome: 11
Transcript: ENST00000532946
Biotype: antisense
Gene id: ENSG00000255108
Gene Name: AP006621.8
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-449a
Sequence: uggcaguguauuguuagcuggu
MirBase ID: MIMAT0001541
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
11:823766-823794
exon
HITS-CLIP
DIRECT
LncBasev2
ARRDC1-AS1
hsa-miR-449a
IP

Gene Details
Chromosome: 9
Transcript: ENST00000623970
Biotype: antisense
Gene id: ENSG00000203993
Gene Name: ARRDC1-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-449a
Sequence: uggcaguguauuguuagcuggu
MirBase ID: MIMAT0001541
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
9:137618199-137618227
exon
HITS-CLIP
DIRECT
LncBasev2
BZW1P1
hsa-miR-449a
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000454901
Biotype: processed_pseudogene
Gene id: ENSG00000236686
Gene Name: BZW1P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-449a
Sequence: uggcaguguauuguuagcuggu
MirBase ID: MIMAT0001541
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
3:172426824-172426852
exon
HITS-CLIP
DIRECT
LncBasev2
BZW1P2
hsa-miR-449a
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000473537
Biotype: processed_pseudogene
Gene id: ENSG00000198406
Gene Name: BZW1P2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-449a
Sequence: uggcaguguauuguuagcuggu
MirBase ID: MIMAT0001541
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:116646493-116646521
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: LCLBACD1
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:116646493-116646521
exon
PAR-CLIP
DIRECT
LncBasev2
C14orf132
hsa-miR-449a
IP

Gene Details
Chromosome: 14
Transcript: ENST00000555004
Biotype: lincRNA
Gene id: ENSG00000227051
Gene Name: C14orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-449a
Sequence: uggcaguguauuguuagcuggu
MirBase ID: MIMAT0001541
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:96089444-96089479
exon
HITS-CLIP
DIRECT
LncBasev2
C1orf132
hsa-miR-449a
IP

Gene Details
Chromosome: 1
Transcript: ENST00000608023
Biotype: lincRNA
Gene id: ENSG00000203709
Gene Name: C1orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-449a
Sequence: uggcaguguauuguuagcuggu
MirBase ID: MIMAT0001541
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
1:207812047-207812085
exon
HITS-CLIP
DIRECT
LncBasev2
C1orf213
hsa-miR-449a
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000335648
Biotype: antisense
Gene id: ENSG00000249087
Gene Name: C1orf213
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-449a
Sequence: uggcaguguauuguuagcuggu
MirBase ID: MIMAT0001541
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:23370304-23370332
exon
HITS-CLIP
DIRECT
LncBasev2
CECR7
hsa-miR-449a
IP

Gene Details
Chromosome: 22
Transcript: ENST00000441006
Biotype: lincRNA
Gene id: ENSG00000237438
Gene Name: CECR7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-449a
Sequence: uggcaguguauuguuagcuggu
MirBase ID: MIMAT0001541
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:17058783-17058811
exon
HITS-CLIP
DIRECT
LncBasev2
chr22-38_28785274-29006793.1
hsa-miR-449a
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-449a
Sequence: uggcaguguauuguuagcuggu
MirBase ID: MIMAT0001541
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:29054163-29054191
exon
HITS-CLIP
DIRECT
LncBasev2
CKMT2-AS1
hsa-miR-449a
IP

Gene Details
Chromosome: 5
Transcript: ENST00000501927
Biotype: antisense
Gene id: ENSG00000247572
Gene Name: CKMT2-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-449a
Sequence: uggcaguguauuguuagcuggu
MirBase ID: MIMAT0001541
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:81238498-81238526
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-338M12.4
hsa-miR-449a
IP

Gene Details
Chromosome: 5
Transcript: ENST00000417281
Biotype: antisense
Gene id: ENSG00000233937
Gene Name: CTC-338M12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-449a
Sequence: uggcaguguauuguuagcuggu
MirBase ID: MIMAT0001541
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
5:181247785-181247813
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-359D24.3
hsa-miR-449a
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000472362
Biotype: processed_transcript
Gene id: ENSG00000242615
Gene Name: CTC-359D24.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-449a
Sequence: uggcaguguauuguuagcuggu
MirBase ID: MIMAT0001541
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:12143018-12143046
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-449a
IP

Gene Details
Chromosome: 5
Transcript: ENST00000534918
Biotype: retained_intron
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-449a
Sequence: uggcaguguauuguuagcuggu
MirBase ID: MIMAT0001541
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
5:478269-478297
exon
HITS-CLIP
DIRECT
LncBasev2
5:478319-478347
exon
HITS-CLIP
DIRECT
LncBasev2
5:478879-478907
exon
HITS-CLIP
DIRECT
LncBasev2
5:478647-478675
exon
HITS-CLIP
DIRECT
LncBasev2
5:478269-478297
exon
HITS-CLIP
DIRECT
LncBasev2
5:478647-478675
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: