Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-455-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AATK-AS1
hsa-miR-455-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000414089
Biotype: antisense
Gene id: ENSG00000225180
Gene Name: AATK-AS1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
17:81166811-81166839
exon
HITS-CLIP
DIRECT
LncBasev2
AC084082.3
hsa-miR-455-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000517961
Biotype: lincRNA
Gene id: ENSG00000253190
Gene Name: AC084082.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:66113373-66113401
exon
HITS-CLIP
DIRECT
LncBasev2
8:66113373-66113401
exon
HITS-CLIP
DIRECT
LncBasev2
AC090587.2
hsa-miR-455-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000507938
Biotype: sense_overlapping
Gene id: ENSG00000250404
Gene Name: AC090587.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
11:3821406-3821434
exon
HITS-CLIP
DIRECT
LncBasev2
AHCTF1P1
hsa-miR-455-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000420969
Biotype: processed_pseudogene
Gene id: ENSG00000226121
Gene Name: AHCTF1P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:161505728-161505756
exon
HITS-CLIP
DIRECT
LncBasev2
C1orf132
hsa-miR-455-3p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000608023
Biotype: lincRNA
Gene id: ENSG00000203709
Gene Name: C1orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
1:207815442-207815470
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-455-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
8:140521790-140521818
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-89H12.4
hsa-miR-455-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499521
Biotype: retained_intron
Gene id: ENSG00000230551
Gene Name: CTB-89H12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
5:149495661-149495689
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-273B12.8
hsa-miR-455-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000427476
Biotype: lincRNA
Gene id: ENSG00000269751
Gene Name: CTC-273B12.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
19:48480836-48480864
exon
HITS-CLIP
DIRECT
LncBasev2
19:48480836-48480864
exon
HITS-CLIP
DIRECT
LncBasev2
19:48472327-48472355
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-550B14.6
hsa-miR-455-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000585492
Biotype: processed_transcript
Gene id: ENSG00000267149
Gene Name: CTC-550B14.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
19:55044912-55044940
exon
HITS-CLIP
DIRECT
LncBasev2
DDR1-AS1
hsa-miR-455-3p
IP

Gene Details
Chromosome: 6
Transcript: ENST00000458361
Biotype: antisense
Gene id: ENSG00000237775
Gene Name: DDR1-AS1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
6:30875168-30875196
exon
HITS-CLIP
DIRECT
LncBasev2
ENO1P1
hsa-miR-455-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000366587
Biotype: transcribed_processed_pseudogene
Gene id: ENSG00000244457
Gene Name: ENO1P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
1:236483825-236483853
exon
HITS-CLIP
DIRECT
LncBasev2
1:236483825-236483853
exon
HITS-CLIP
DIRECT
LncBasev2
1:236483825-236483853
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:236483825-236483853
exon
HITS-CLIP
DIRECT
LncBasev2
HCG18
hsa-miR-455-3p
IP

Gene Details
Chromosome: 6
Transcript: ENST00000426882
Biotype: antisense
Gene id: ENSG00000231074
Gene Name: HCG18
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
6:30326619-30326647
exon
HITS-CLIP
DIRECT
LncBasev2
HNRNPA1P54
hsa-miR-455-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000411857
Biotype: processed_pseudogene
Gene id: ENSG00000236539
Gene Name: HNRNPA1P54
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
1:179456052-179456080
exon
HITS-CLIP
DIRECT
LncBasev2
HNRNPU-AS1
hsa-miR-455-3p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000366527
Biotype: antisense
Gene id: ENSG00000188206
Gene Name: HNRNPU-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
1:244842336-244842364
exon
HITS-CLIP
DIRECT
LncBasev2
KCNQ1OT1
hsa-miR-455-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
11:2687033-2687061
exon
HITS-CLIP
DIRECT
LncBasev2
11:2687033-2687061
exon
HITS-CLIP
DIRECT
LncBasev2
11:2684310-2684338
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00641
hsa-miR-455-3p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000555379
Biotype: retained_intron
Gene id: ENSG00000258441
Gene Name: LINC00641
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
14:21203786-21203814
exon
HITS-CLIP
DIRECT
LncBasev2
LOC100289230
hsa-miR-455-3p
IP

Gene Details
Chromosome: 5
Transcript: NR_036530.1
Biotype: lincRNA
Gene id: NR_036530.1 (gene)
Gene Name: LOC100289230
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
5:98929378-98929406
exon
HITS-CLIP
DIRECT
LncBasev2
LOC90784
hsa-miR-455-3p
IP

Gene Details
Chromosome: 2
Transcript: NR_026984.1
Biotype: sense
Gene id: NR_026984.1 (gene)
Gene Name: LOC90784
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
2:86021251-86021279
exon
HITS-CLIP
DIRECT
LncBasev2
MALAT1
hsa-miR-455-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000534336
Biotype: lincRNA
Gene id: ENSG00000251562
Gene Name: MALAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
11:65501644-65501672
exon
HITS-CLIP
DIRECT
LncBasev2
11:65500943-65500971
exon
HITS-CLIP
DIRECT
LncBasev2
11:65500151-65500179
exon
HITS-CLIP
DIRECT
LncBasev2
11:65500457-65500485
exon
HITS-CLIP
DIRECT
LncBasev2
11:65500943-65500971
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504610-65504638
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501644-65501672
exon
HITS-CLIP
DIRECT
LncBasev2
11:65500151-65500179
exon
HITS-CLIP
DIRECT
LncBasev2
11:65500457-65500485
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504610-65504638
exon
HITS-CLIP
DIRECT
LncBasev2
11:65500457-65500485
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501644-65501672
exon
HITS-CLIP
DIRECT
LncBasev2
11:65500151-65500179
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504610-65504638
exon
HITS-CLIP
DIRECT
LncBasev2
11:65500943-65500971
exon
HITS-CLIP
DIRECT
LncBasev2
11:65500457-65500485
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501644-65501672
exon
HITS-CLIP
DIRECT
LncBasev2
11:65500151-65500179
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504610-65504638
exon
HITS-CLIP
DIRECT
LncBasev2
11:65500457-65500485
exon
HITS-CLIP
DIRECT
LncBasev2
11:65500943-65500971
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501644-65501672
exon
HITS-CLIP
DIRECT
LncBasev2
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65504610-65504638
exon
HITS-CLIP
DIRECT
LncBasev2
11:65500943-65500971
exon
HITS-CLIP
DIRECT
LncBasev2
11:65500151-65500179
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504610-65504638
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504610-65504638
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501644-65501672
exon
HITS-CLIP
DIRECT
LncBasev2
11:65500943-65500971
exon
HITS-CLIP
DIRECT
LncBasev2
MAPK6PS2
hsa-miR-455-3p
-
IP

Gene Details
Chromosome: 21
Transcript: ENST00000379571
Biotype: processed_pseudogene
Gene id: ENSG00000223488
Gene Name: MAPK6PS2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
21:22436955-22436983
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: