Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-484

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC002310.7
hsa-miR-484
IP

Gene Details
Chromosome: 16
Transcript: ENST00000492040
Biotype: antisense
Gene id: ENSG00000239791
Gene Name: AC002310.7
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-484
Sequence: ucaggcucaguccccucccgau
MirBase ID: MIMAT0002174
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
16:30583135-30583163
exon
HITS-CLIP
DIRECT
LncBasev2
AC005154.6
hsa-miR-484
IP

Gene Details
Chromosome: 7
Transcript: ENST00000578245
Biotype: retained_intron
Gene id: ENSG00000196295
Gene Name: AC005154.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-484
Sequence: ucaggcucaguccccucccgau
MirBase ID: MIMAT0002174
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30577677-30577705
exon
HITS-CLIP
DIRECT
LncBasev2
AC005592.3
hsa-miR-484
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000566527
Biotype: lincRNA
Gene id: ENSG00000261757
Gene Name: AC005592.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-484
Sequence: ucaggcucaguccccucccgau
MirBase ID: MIMAT0002174
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:142705318-142705346
exon
HITS-CLIP
DIRECT
LncBasev2
AC007283.5
hsa-miR-484
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000434645
Biotype: lincRNA
Gene id: ENSG00000234431
Gene Name: AC007283.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-484
Sequence: ucaggcucaguccccucccgau
MirBase ID: MIMAT0002174
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:201167132-201167160
exon
HITS-CLIP
DIRECT
LncBasev2
AC008746.12
hsa-miR-484
IP

Gene Details
Chromosome: 19
Transcript: ENST00000599382
Biotype: lincRNA
Gene id: ENSG00000267838
Gene Name: AC008746.12
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-484
Sequence: ucaggcucaguccccucccgau
MirBase ID: MIMAT0002174
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
19:54439206-54439234
exon
HITS-CLIP
DIRECT
LncBasev2
AC017074.1
hsa-miR-484
IP

Gene Details
Chromosome: 2
Transcript: ENST00000439382
Biotype: lincRNA
Gene id: ENSG00000233479
Gene Name: AC017074.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-484
Sequence: ucaggcucaguccccucccgau
MirBase ID: MIMAT0002174
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
2:113672896-113672924
exon
HITS-CLIP
DIRECT
LncBasev2
AC018738.2
hsa-miR-484
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000441378
Biotype: processed_pseudogene
Gene id: ENSG00000237039
Gene Name: AC018738.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-484
Sequence: ucaggcucaguccccucccgau
MirBase ID: MIMAT0002174
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:231256284-231256312
exon
HITS-CLIP
DIRECT
LncBasev2
AC092933.4
hsa-miR-484
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000393644
Biotype: unprocessed_pseudogene
Gene id: ENSG00000213358
Gene Name: AC092933.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-484
Sequence: ucaggcucaguccccucccgau
MirBase ID: MIMAT0002174
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
3:196527905-196527933
exon
HITS-CLIP
DIRECT
LncBasev2
AC093673.5
hsa-miR-484
IP

Gene Details
Chromosome: 7
Transcript: ENST00000429630
Biotype: antisense
Gene id: ENSG00000232533
Gene Name: AC093673.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-484
Sequence: ucaggcucaguccccucccgau
MirBase ID: MIMAT0002174
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:143379802-143379830
exon
HITS-CLIP
DIRECT
LncBasev2
AC105339.1
hsa-miR-484
IP

Gene Details
Chromosome: 15
Transcript: ENST00000440479
Biotype: lincRNA
Gene id: ENSG00000228141
Gene Name: AC105339.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Colon Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary

miRNA Details
Name: hsa-miR-484
Sequence: ucaggcucaguccccucccgau
MirBase ID: MIMAT0002174
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
15:82711780-82711808
exon
HITS-CLIP
DIRECT
LncBasev2
AF186192.6
hsa-miR-484
IP

Gene Details
Chromosome: 8
Transcript: ENST00000583427
Biotype: lincRNA
Gene id: ENSG00000263612
Gene Name: AF186192.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-484
Sequence: ucaggcucaguccccucccgau
MirBase ID: MIMAT0002174
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HEK293
Category: Embryonic/Fetal
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:144713950-144713978
exon
PAR-CLIP
DIRECT
LncBasev2
Tested Cell Line: LCLBACD3
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:144713950-144713978
exon
PAR-CLIP
DIRECT
LncBasev2
Tested Cell Line: HEK293
Category: Embryonic/Fetal
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:144713950-144713978
exon
PAR-CLIP
DIRECT
LncBasev2
AL450992.2
hsa-miR-484
IP

Gene Details
Chromosome: 1
Transcript: ENST00000434182
Biotype: antisense
Gene id: ENSG00000234614
Gene Name: AL450992.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-484
Sequence: ucaggcucaguccccucccgau
MirBase ID: MIMAT0002174
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:151850307-151850335
exon
HITS-CLIP
DIRECT
LncBasev2
ALDOAP1
hsa-miR-484
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000491506
Biotype: processed_pseudogene
Gene id: ENSG00000242849
Gene Name: ALDOAP1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-484
Sequence: ucaggcucaguccccucccgau
MirBase ID: MIMAT0002174
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:52194119-52194147
exon
HITS-CLIP
DIRECT
LncBasev2
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:52194119-52194147
exon
HITS-CLIP
DIRECT
LncBasev2
AP000347.2
hsa-miR-484
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000417194
Biotype: processed_transcript
Gene id: ENSG00000272578
Gene Name: AP000347.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-484
Sequence: ucaggcucaguccccucccgau
MirBase ID: MIMAT0002174
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:23692954-23692982
exon
HITS-CLIP
DIRECT
LncBasev2
22:23691374-23691402
exon
HITS-CLIP
DIRECT
LncBasev2
AP003774.4
hsa-miR-484
IP

Gene Details
Chromosome: 11
Transcript: ENST00000316124
Biotype: lincRNA
Gene id: ENSG00000181908
Gene Name: AP003774.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-484
Sequence: ucaggcucaguccccucccgau
MirBase ID: MIMAT0002174
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
11:64449500-64449528
exon
HITS-CLIP
DIRECT
LncBasev2
AP006621.5
hsa-miR-484
IP

Gene Details
Chromosome: 11
Transcript: ENST00000530083
Biotype: lincRNA
Gene id: ENSG00000255284
Gene Name: AP006621.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-484
Sequence: ucaggcucaguccccucccgau
MirBase ID: MIMAT0002174
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
11:777654-777682
exon
HITS-CLIP
DIRECT
LncBasev2
APOC4-APOC2
hsa-miR-484
IP

Gene Details
Chromosome: 19
Transcript: NR_037932.1
Biotype: sense
Gene id: NR_037932.1 (gene)
Gene Name: APOC4-APOC2
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-484
Sequence: ucaggcucaguccccucccgau
MirBase ID: MIMAT0002174
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:44949339-44949367
exon
HITS-CLIP
DIRECT
LncBasev2
BACE2-IT1
hsa-miR-484
-
IP

Gene Details
Chromosome: 21
Transcript: ENST00000433378
Biotype: antisense
Gene id: ENSG00000224388
Gene Name: BACE2-IT1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-484
Sequence: ucaggcucaguccccucccgau
MirBase ID: MIMAT0002174
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
21:41180264-41180292
exon
HITS-CLIP
DIRECT
LncBasev2
BBOX1-AS1
hsa-miR-484
IP

Gene Details
Chromosome: 11
Transcript: ENST00000530430
Biotype: antisense
Gene id: ENSG00000254560
Gene Name: BBOX1-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-484
Sequence: ucaggcucaguccccucccgau
MirBase ID: MIMAT0002174
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
11:27151056-27151084
exon
HITS-CLIP
DIRECT
LncBasev2
BNIP3P1
hsa-miR-484
-
IP

Gene Details
Chromosome: 14
Transcript: ENST00000550043
Biotype: processed_transcript
Gene id: ENSG00000197358
Gene Name: BNIP3P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-484
Sequence: ucaggcucaguccccucccgau
MirBase ID: MIMAT0002174
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:28264689-28264717
exon
HITS-CLIP
DIRECT
LncBasev2
14:28264568-28264596
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: