Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-499a-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC000099.1
hsa-miR-499a-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000413812
Biotype: antisense
Gene id: ENSG00000236340
Gene Name: AC000099.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-499a-3p
Sequence: aacaucacagcaagucugugcu
MirBase ID: MIMAT0004772
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:127228466-127228494
exon
HITS-CLIP
DIRECT
LncBasev2
ARHGAP19-SLIT1
hsa-miR-499a-3p
IP

Gene Details
Chromosome: 10
Transcript: NR_037909.1
Biotype: sense
Gene id: NR_037909.1 (gene)
Gene Name: ARHGAP19-SLIT1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-499a-3p
Sequence: aacaucacagcaagucugugcu
MirBase ID: MIMAT0004772
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
10:97263505-97263533
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-499a-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-499a-3p
Sequence: aacaucacagcaagucugugcu
MirBase ID: MIMAT0004772
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140528161-140528189
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
8:140525112-140525140
exon
HITS-CLIP
DIRECT
LncBasev2
8:140524082-140524110
exon
HITS-CLIP
DIRECT
LncBasev2
8:140524082-140524110
exon
HITS-CLIP
DIRECT
LncBasev2
CLUHP3
hsa-miR-499a-3p
-
IP

Gene Details
Chromosome: 16
Transcript: ENST00000562354
Biotype: processed_transcript
Gene id: ENSG00000131797
Gene Name: CLUHP3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-499a-3p
Sequence: aacaucacagcaagucugugcu
MirBase ID: MIMAT0004772
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:31708818-31708846
exon
HITS-CLIP
DIRECT
LncBasev2
CTA-445C9.14
hsa-miR-499a-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000566814
Biotype: antisense
Gene id: ENSG00000261188
Gene Name: CTA-445C9.14
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-499a-3p
Sequence: aacaucacagcaagucugugcu
MirBase ID: MIMAT0004772
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:26514376-26514404
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-58E17.5
hsa-miR-499a-3p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000610658
Biotype: antisense
Gene id: ENSG00000277182
Gene Name: CTB-58E17.5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-499a-3p
Sequence: aacaucacagcaagucugugcu
MirBase ID: MIMAT0004772
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
17:38751167-38751195
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-529I10.1
hsa-miR-499a-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000616896
Biotype: antisense
Gene id: ENSG00000275413
Gene Name: CTC-529I10.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-499a-3p
Sequence: aacaucacagcaagucugugcu
MirBase ID: MIMAT0004772
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:16023449-16023477
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2538A21.1
hsa-miR-499a-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000507713
Biotype: processed_pseudogene
Gene id: ENSG00000225165
Gene Name: CTD-2538A21.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-499a-3p
Sequence: aacaucacagcaagucugugcu
MirBase ID: MIMAT0004772
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:95440329-95440357
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2666L21.3
hsa-miR-499a-3p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000461223
Biotype: processed_pseudogene
Gene id: ENSG00000213293
Gene Name: CTD-2666L21.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-499a-3p
Sequence: aacaucacagcaagucugugcu
MirBase ID: MIMAT0004772
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:12260472-12260500
exon
HITS-CLIP
DIRECT
LncBasev2
DDX3YP3
hsa-miR-499a-3p
-
IP

Gene Details
Chromosome: 4
Transcript: ENST00000506389
Biotype: processed_pseudogene
Gene id: ENSG00000251571
Gene Name: DDX3YP3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-499a-3p
Sequence: aacaucacagcaagucugugcu
MirBase ID: MIMAT0004772
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:103573110-103573138
exon
HITS-CLIP
DIRECT
LncBasev2
DYNC1I2P1
hsa-miR-499a-3p
-
IP

Gene Details
Chromosome: 10
Transcript: ENST00000435916
Biotype: processed_pseudogene
Gene id: ENSG00000225137
Gene Name: DYNC1I2P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-499a-3p
Sequence: aacaucacagcaagucugugcu
MirBase ID: MIMAT0004772
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:50265880-50265908
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P13
hsa-miR-499a-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000503537
Biotype: processed_pseudogene
Gene id: ENSG00000250182
Gene Name: EEF1A1P13
UCSC graphic:
Expression:
  Cell Line Tissue Category
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-499a-3p
Sequence: aacaucacagcaagucugugcu
MirBase ID: MIMAT0004772
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:14652367-14652395
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P16
hsa-miR-499a-3p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000325349
Biotype: processed_pseudogene
Gene id: ENSG00000213235
Gene Name: EEF1A1P16
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-499a-3p
Sequence: aacaucacagcaagucugugcu
MirBase ID: MIMAT0004772
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:16991592-16991620
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P19
hsa-miR-499a-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000513637
Biotype: processed_pseudogene
Gene id: ENSG00000249855
Gene Name: EEF1A1P19
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-499a-3p
Sequence: aacaucacagcaagucugugcu
MirBase ID: MIMAT0004772
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:43495499-43495527
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P24
hsa-miR-499a-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000451469
Biotype: processed_pseudogene
Gene id: ENSG00000223668
Gene Name: EEF1A1P24
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-499a-3p
Sequence: aacaucacagcaagucugugcu
MirBase ID: MIMAT0004772
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:39359474-39359502
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P3
hsa-miR-499a-3p
-
IP

Gene Details
Chromosome: 13
Transcript: ENST00000417549
Biotype: processed_pseudogene
Gene id: ENSG00000232587
Gene Name: EEF1A1P3
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-499a-3p
Sequence: aacaucacagcaagucugugcu
MirBase ID: MIMAT0004772
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
13:28215767-28215795
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P33
hsa-miR-499a-3p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000554413
Biotype: processed_pseudogene
Gene id: ENSG00000258846
Gene Name: EEF1A1P33
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-499a-3p
Sequence: aacaucacagcaagucugugcu
MirBase ID: MIMAT0004772
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:96901469-96901497
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P9
hsa-miR-499a-3p
-
IP

Gene Details
Chromosome: 4
Transcript: ENST00000514975
Biotype: processed_pseudogene
Gene id: ENSG00000249264
Gene Name: EEF1A1P9
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-499a-3p
Sequence: aacaucacagcaagucugugcu
MirBase ID: MIMAT0004772
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:105485623-105485651
exon
HITS-CLIP
DIRECT
LncBasev2
EIF4A1P10
hsa-miR-499a-3p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000428832
Biotype: processed_pseudogene
Gene id: ENSG00000229132
Gene Name: EIF4A1P10
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-499a-3p
Sequence: aacaucacagcaagucugugcu
MirBase ID: MIMAT0004772
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:92113448-92113476
exon
HITS-CLIP
DIRECT
LncBasev2
ERVK3-1
hsa-miR-499a-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000590505
Biotype: retained_intron
Gene id: ENSG00000142396
Gene Name: ERVK3-1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-499a-3p
Sequence: aacaucacagcaagucugugcu
MirBase ID: MIMAT0004772
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
19:58314815-58314843
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: