Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-499a-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
ANP32A-IT1
hsa-miR-499a-5p
IP

Gene Details
Chromosome: 15
Transcript: NR_026808.1
Biotype: sense
Gene id: NR_026808.1 (gene)
Gene Name: ANP32A-IT1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-499a-5p
Sequence: uuaagacuugcagugauguuu
MirBase ID: MIMAT0002870
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
15:68806438-68806466
exon
HITS-CLIP
DIRECT
LncBasev2
AP000347.2
hsa-miR-499a-5p
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000417194
Biotype: processed_transcript
Gene id: ENSG00000272578
Gene Name: AP000347.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-499a-5p
Sequence: uuaagacuugcagugauguuu
MirBase ID: MIMAT0002870
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
22:23691101-23691129
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-273B12.8
hsa-miR-499a-5p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000427476
Biotype: lincRNA
Gene id: ENSG00000269751
Gene Name: CTC-273B12.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-499a-5p
Sequence: uuaagacuugcagugauguuu
MirBase ID: MIMAT0002870
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
19:48481179-48481207
exon
HITS-CLIP
DIRECT
LncBasev2
GAS5
hsa-miR-499a-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000431268
Biotype: retained_intron
Gene id: ENSG00000234741
Gene Name: GAS5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-499a-5p
Sequence: uuaagacuugcagugauguuu
MirBase ID: MIMAT0002870
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
1:173866657-173866685
exon
HITS-CLIP
DIRECT
LncBasev2
1:173866657-173866685
exon
HITS-CLIP
DIRECT
LncBasev2
1:173866642-173866685
exon
HITS-CLIP
DIRECT
LncBasev2
1:173866657-173866685
exon
HITS-CLIP
DIRECT
LncBasev2
1:173866642-173866685
exon
HITS-CLIP
DIRECT
LncBasev2
1:173866657-173866685
exon
HITS-CLIP
DIRECT
LncBasev2
GAS5
hsa-miR-499a-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000421068
Biotype: retained_intron
Gene id: ENSG00000234741
Gene Name: GAS5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-499a-5p
Sequence: uuaagacuugcagugauguuu
MirBase ID: MIMAT0002870
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
1:173865984-173866012
exon
HITS-CLIP
DIRECT
LncBasev2
1:173865984-173866012
exon
HITS-CLIP
DIRECT
LncBasev2
GUSBP11
hsa-miR-499a-5p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000455485
Biotype: processed_transcript
Gene id: ENSG00000228315
Gene Name: GUSBP11
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-499a-5p
Sequence: uuaagacuugcagugauguuu
MirBase ID: MIMAT0002870
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
22:23691101-23691129
exon
HITS-CLIP
DIRECT
LncBasev2
HCG18
hsa-miR-499a-5p
IP

Gene Details
Chromosome: 6
Transcript: ENST00000426882
Biotype: antisense
Gene id: ENSG00000231074
Gene Name: HCG18
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-499a-5p
Sequence: uuaagacuugcagugauguuu
MirBase ID: MIMAT0002870
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
6:30291485-30291513
exon
HITS-CLIP
DIRECT
LncBasev2
LINC01197
hsa-miR-499a-5p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000508732
Biotype: lincRNA
Gene id: ENSG00000248441
Gene Name: LINC01197
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
HUVEC Blood Vessel Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary

miRNA Details
Name: hsa-miR-499a-5p
Sequence: uuaagacuugcagugauguuu
MirBase ID: MIMAT0002870
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBACD1
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:95279765-95279793
exon
PAR-CLIP
DIRECT
LncBasev2
LINC01197
hsa-miR-499a-5p
IP

Gene Details
Chromosome: 15
Transcript: NR_034095.1
Biotype: lincRNA
Gene id: NR_034095.1 (gene)
Gene Name: LINC01197
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary

miRNA Details
Name: hsa-miR-499a-5p
Sequence: uuaagacuugcagugauguuu
MirBase ID: MIMAT0002870
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBACD1
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:95279765-95279793
exon
PAR-CLIP
DIRECT
LncBasev2
LINC01515
hsa-miR-499a-5p
-
IP

Gene Details
Chromosome: 10
Transcript: ENST00000433152
Biotype: lincRNA
Gene id: ENSG00000228065
Gene Name: LINC01515
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-499a-5p
Sequence: uuaagacuugcagugauguuu
MirBase ID: MIMAT0002870
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
10:65571495-65571523
exon
HITS-CLIP
DIRECT
LncBasev2
LOC401324
hsa-miR-499a-5p
IP

Gene Details
Chromosome: 7
Transcript: NR_038864.1
Biotype: lincRNA
Gene id: NR_038864.1 (gene)
Gene Name: LOC401324
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-miR-499a-5p
Sequence: uuaagacuugcagugauguuu
MirBase ID: MIMAT0002870
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
7:35373486-35373514
exon
HITS-CLIP
DIRECT
LncBasev2
MAGI2-AS3
hsa-miR-499a-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000452320
Biotype: retained_intron
Gene id: ENSG00000234456
Gene Name: MAGI2-AS3
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-499a-5p
Sequence: uuaagacuugcagugauguuu
MirBase ID: MIMAT0002870
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
7:79459826-79459854
exon
HITS-CLIP
DIRECT
LncBasev2
MALAT1
hsa-miR-499a-5p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000534336
Biotype: lincRNA
Gene id: ENSG00000251562
Gene Name: MALAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-499a-5p
Sequence: uuaagacuugcagugauguuu
MirBase ID: MIMAT0002870
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
11:65504516-65504544
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501799-65501836
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501939-65501967
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505189-65505217
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504516-65504544
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504778-65504806
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505368-65505396
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501511-65501539
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505189-65505217
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501939-65501967
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501511-65501539
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504778-65504806
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501799-65501836
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504516-65504544
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501799-65501836
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505368-65505396
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504778-65504806
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505189-65505217
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501799-65501827
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505189-65505217
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504516-65504544
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505368-65505396
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505189-65505217
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504778-65504806
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: EF3DAGO2
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65504778-65504806
exon
PAR-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-499a-5p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-499a-5p
Sequence: uuaagacuugcagugauguuu
MirBase ID: MIMAT0002870
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
11:65444947-65444975
exon
HITS-CLIP
DIRECT
LncBasev2
11:65430426-65430454
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425534-65425562
exon
HITS-CLIP
DIRECT
LncBasev2
11:65430426-65430454
exon
HITS-CLIP
DIRECT
LncBasev2
11:65427455-65427483
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425238-65425266
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425534-65425562
exon
HITS-CLIP
DIRECT
LncBasev2
11:65429225-65429253
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425238-65425266
exon
HITS-CLIP
DIRECT
LncBasev2
11:65427455-65427483
exon
HITS-CLIP
DIRECT
LncBasev2
11:65430426-65430454
exon
HITS-CLIP
DIRECT
LncBasev2
11:65427455-65427483
exon
HITS-CLIP
DIRECT
LncBasev2
11:65444947-65444975
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425534-65425562
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425238-65425266
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425238-65425266
exon
HITS-CLIP
DIRECT
LncBasev2
11:65439814-65439842
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425534-65425562
exon
HITS-CLIP
DIRECT
LncBasev2
11:65444947-65444975
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425534-65425562
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425238-65425266
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-499a-5p
IP

Gene Details
Chromosome: 11
Transcript: NR_028272.1
Biotype: lincRNA
Gene id: NR_028272.1 (gene)
Gene Name: NEAT1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-499a-5p
Sequence: uuaagacuugcagugauguuu
MirBase ID: MIMAT0002870
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
11:65425238-65425266
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425238-65425266
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425534-65425562
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425238-65425266
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425534-65425562
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425534-65425562
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425238-65425266
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425238-65425266
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425534-65425562
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425534-65425562
exon
HITS-CLIP
DIRECT
LncBasev2
OIP5-AS1
hsa-miR-499a-5p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000500949
Biotype: antisense
Gene id: ENSG00000247556
Gene Name: OIP5-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-499a-5p
Sequence: uuaagacuugcagugauguuu
MirBase ID: MIMAT0002870
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
15:41300894-41300922
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-474P12.3
hsa-miR-499a-5p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000411625
Biotype: processed_pseudogene
Gene id: ENSG00000177736
Gene Name: RP11-474P12.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-499a-5p
Sequence: uuaagacuugcagugauguuu
MirBase ID: MIMAT0002870
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
9:124968530-124968558
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-553L6.5
hsa-miR-499a-5p
IP

Gene Details
Chromosome: 3
Transcript: ENST00000570269
Biotype: lincRNA
Gene id: ENSG00000259976
Gene Name: RP11-553L6.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-499a-5p
Sequence: uuaagacuugcagugauguuu
MirBase ID: MIMAT0002870
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBAC
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:114315997-114316025
exon
PAR-CLIP
DIRECT
LncBasev2
RP6-24A23.7
hsa-miR-499a-5p
IP

Gene Details
Chromosome: X
Transcript: ENST00000564206
Biotype: sense_overlapping
Gene id: ENSG00000261409
Gene Name: RP6-24A23.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-499a-5p
Sequence: uuaagacuugcagugauguuu
MirBase ID: MIMAT0002870
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
X:108723201-108723229
exon
HITS-CLIP
DIRECT
LncBasev2
SNHG1
hsa-miR-499a-5p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000538654
Biotype: retained_intron
Gene id: ENSG00000255717
Gene Name: SNHG1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-499a-5p
Sequence: uuaagacuugcagugauguuu
MirBase ID: MIMAT0002870
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
11:62853006-62853034
exon
HITS-CLIP
DIRECT
LncBasev2
11:62853006-62853034
exon
HITS-CLIP
DIRECT
LncBasev2
11:62853006-62853034
exon
HITS-CLIP
DIRECT
LncBasev2
11:62854996-62855024
exon
HITS-CLIP
DIRECT
LncBasev2
11:62853006-62853034
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: LCL35
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:62853006-62853034
exon
PAR-CLIP
DIRECT
LncBasev2
Funded by: