Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-5006-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC009506.1
hsa-miR-5006-3p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000418474
Biotype: antisense
Gene id: ENSG00000224152
Gene Name: AC009506.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-5006-3p
Sequence: uuucccuuuccauccuggcag
MirBase ID: MIMAT0021034
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:159615765-159615794
exon
HITS-CLIP
DIRECT
LncBasev2
AC011737.2
hsa-miR-5006-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000431098
Biotype: processed_pseudogene
Gene id: ENSG00000204196
Gene Name: AC011737.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-5006-3p
Sequence: uuucccuuuccauccuggcag
MirBase ID: MIMAT0021034
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:203191262-203191290
exon
HITS-CLIP
DIRECT
LncBasev2
AC022431.1
hsa-miR-5006-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000450941
Biotype: processed_pseudogene
Gene id: ENSG00000226221
Gene Name: AC022431.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-5006-3p
Sequence: uuucccuuuccauccuggcag
MirBase ID: MIMAT0021034
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:56504808-56504836
exon
HITS-CLIP
DIRECT
LncBasev2
AC023481.1
hsa-miR-5006-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000435368
Biotype: lincRNA
Gene id: ENSG00000231401
Gene Name: AC023481.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-5006-3p
Sequence: uuucccuuuccauccuggcag
MirBase ID: MIMAT0021034
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:8365702-8365736
exon
HITS-CLIP
DIRECT
LncBasev2
AC092155.1
hsa-miR-5006-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000454675
Biotype: processed_pseudogene
Gene id: ENSG00000229503
Gene Name: AC092155.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-5006-3p
Sequence: uuucccuuuccauccuggcag
MirBase ID: MIMAT0021034
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:62532927-62532955
exon
HITS-CLIP
DIRECT
LncBasev2
ACTBP9
hsa-miR-5006-3p
-
IP

Gene Details
Chromosome: 18
Transcript: ENST00000587663
Biotype: processed_pseudogene
Gene id: ENSG00000266920
Gene Name: ACTBP9
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-5006-3p
Sequence: uuucccuuuccauccuggcag
MirBase ID: MIMAT0021034
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
18:62442604-62442632
exon
HITS-CLIP
DIRECT
LncBasev2
AHCTF1P1
hsa-miR-5006-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000420969
Biotype: processed_pseudogene
Gene id: ENSG00000226121
Gene Name: AHCTF1P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-5006-3p
Sequence: uuucccuuuccauccuggcag
MirBase ID: MIMAT0021034
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:161507553-161507581
exon
HITS-CLIP
DIRECT
LncBasev2
APTR
hsa-miR-5006-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000416650
Biotype: lincRNA
Gene id: ENSG00000214293
Gene Name: APTR
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-5006-3p
Sequence: uuucccuuuccauccuggcag
MirBase ID: MIMAT0021034
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:77684165-77684193
exon
HITS-CLIP
DIRECT
LncBasev2
C1orf132
hsa-miR-5006-3p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000608023
Biotype: lincRNA
Gene id: ENSG00000203709
Gene Name: C1orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-5006-3p
Sequence: uuucccuuuccauccuggcag
MirBase ID: MIMAT0021034
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:207806595-207806623
exon
HITS-CLIP
DIRECT
LncBasev2
CEP57L1P1
hsa-miR-5006-3p
-
IP

Gene Details
Chromosome: 10
Transcript: ENST00000430943
Biotype: processed_pseudogene
Gene id: ENSG00000224725
Gene Name: CEP57L1P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-5006-3p
Sequence: uuucccuuuccauccuggcag
MirBase ID: MIMAT0021034
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:70389878-70389906
exon
HITS-CLIP
DIRECT
LncBasev2
CKMT2-AS1
hsa-miR-5006-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000501927
Biotype: antisense
Gene id: ENSG00000247572
Gene Name: CKMT2-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-5006-3p
Sequence: uuucccuuuccauccuggcag
MirBase ID: MIMAT0021034
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:81238522-81238550
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-89H12.4
hsa-miR-5006-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499521
Biotype: retained_intron
Gene id: ENSG00000230551
Gene Name: CTB-89H12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-5006-3p
Sequence: uuucccuuuccauccuggcag
MirBase ID: MIMAT0021034
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149497504-149497532
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2007L18.5
hsa-miR-5006-3p
-
IP

Gene Details
Chromosome: 11
Transcript: ENST00000564469
Biotype: lincRNA
Gene id: ENSG00000260808
Gene Name: CTD-2007L18.5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-5006-3p
Sequence: uuucccuuuccauccuggcag
MirBase ID: MIMAT0021034
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBACD3
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:68616701-68616729
exon
PAR-CLIP
DIRECT
LncBasev2
CTD-2287O16.1
hsa-miR-5006-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000469891
Biotype: processed_pseudogene
Gene id: ENSG00000185641
Gene Name: CTD-2287O16.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-5006-3p
Sequence: uuucccuuuccauccuggcag
MirBase ID: MIMAT0021034
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:116052171-116052199
exon
HITS-CLIP
DIRECT
LncBasev2
DNM3OS
hsa-miR-5006-3p
IP

Gene Details
Chromosome: 1
Transcript: NR_038397.2
Biotype: antisense
Gene id: NR_038397.2 (gene)
Gene Name: DNM3OS
UCSC graphic: -
Expression:
  Cell Line Tissue Category
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-5006-3p
Sequence: uuucccuuuccauccuggcag
MirBase ID: MIMAT0021034
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:172144321-172144349
exon
HITS-CLIP
DIRECT
LncBasev2
DYX1C1-CCPG1
hsa-miR-5006-3p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000565113
Biotype: processed_transcript
Gene id: ENSG00000261771
Gene Name: DYX1C1-CCPG1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-5006-3p
Sequence: uuucccuuuccauccuggcag
MirBase ID: MIMAT0021034
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:55360485-55360513
exon
HITS-CLIP
DIRECT
LncBasev2
15:55360127-55360155
exon
HITS-CLIP
DIRECT
LncBasev2
15:55360391-55360419
exon
HITS-CLIP
DIRECT
LncBasev2
15:55360425-55360453
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P12
hsa-miR-5006-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000443590
Biotype: processed_pseudogene
Gene id: ENSG00000214199
Gene Name: EEF1A1P12
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-5006-3p
Sequence: uuucccuuuccauccuggcag
MirBase ID: MIMAT0021034
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:106698525-106698553
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P14
hsa-miR-5006-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000421195
Biotype: processed_pseudogene
Gene id: ENSG00000233057
Gene Name: EEF1A1P14
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-5006-3p
Sequence: uuucccuuuccauccuggcag
MirBase ID: MIMAT0021034
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:194189090-194189118
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1B2P3
hsa-miR-5006-3p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000447718
Biotype: processed_pseudogene
Gene id: ENSG00000232472
Gene Name: EEF1B2P3
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-5006-3p
Sequence: uuucccuuuccauccuggcag
MirBase ID: MIMAT0021034
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:24788709-24788737
exon
HITS-CLIP
DIRECT
LncBasev2
EIF2S2P4
hsa-miR-5006-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000461070
Biotype: processed_pseudogene
Gene id: ENSG00000128692
Gene Name: EIF2S2P4
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-5006-3p
Sequence: uuucccuuuccauccuggcag
MirBase ID: MIMAT0021034
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:170752326-170752354
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: