Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-518b

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC010492.2
hsa-miR-518b
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000450182
Biotype: processed_pseudogene
Gene id: ENSG00000235081
Gene Name: AC010492.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-518b
Sequence: caaagcgcuccccuuuagaggu
MirBase ID: MIMAT0002844
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:54229100-54229128
exon
HITS-CLIP
DIRECT
LncBasev2
ANXA2P2
hsa-miR-518b
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000435128
Biotype: processed_pseudogene
Gene id: ENSG00000231991
Gene Name: ANXA2P2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-518b
Sequence: caaagcgcuccccuuuagaggu
MirBase ID: MIMAT0002844
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:33624365-33624393
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-89H12.4
hsa-miR-518b
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499521
Biotype: retained_intron
Gene id: ENSG00000230551
Gene Name: CTB-89H12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-518b
Sequence: caaagcgcuccccuuuagaggu
MirBase ID: MIMAT0002844
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149494901-149494929
exon
HITS-CLIP
DIRECT
LncBasev2
5:149494766-149494794
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2262B20.1
hsa-miR-518b
-
IP

Gene Details
Chromosome: 15
Transcript: ENST00000559487
Biotype: transcribed_processed_pseudogene
Gene id: ENSG00000259630
Gene Name: CTD-2262B20.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-518b
Sequence: caaagcgcuccccuuuagaggu
MirBase ID: MIMAT0002844
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:85415294-85415322
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P13
hsa-miR-518b
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000503537
Biotype: processed_pseudogene
Gene id: ENSG00000250182
Gene Name: EEF1A1P13
UCSC graphic:
Expression:
  Cell Line Tissue Category
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-518b
Sequence: caaagcgcuccccuuuagaggu
MirBase ID: MIMAT0002844
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:14652430-14652458
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P16
hsa-miR-518b
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000325349
Biotype: processed_pseudogene
Gene id: ENSG00000213235
Gene Name: EEF1A1P16
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-518b
Sequence: caaagcgcuccccuuuagaggu
MirBase ID: MIMAT0002844
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:16991529-16991557
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P5
hsa-miR-518b
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000436459
Biotype: processed_pseudogene
Gene id: ENSG00000196205
Gene Name: EEF1A1P5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-518b
Sequence: caaagcgcuccccuuuagaggu
MirBase ID: MIMAT0002844
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:133020730-133020758
exon
HITS-CLIP
DIRECT
LncBasev2
HNRNPA1P35
hsa-miR-518b
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000429216
Biotype: processed_pseudogene
Gene id: ENSG00000225695
Gene Name: HNRNPA1P35
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-518b
Sequence: caaagcgcuccccuuuagaggu
MirBase ID: MIMAT0002844
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:201063505-201063533
exon
HITS-CLIP
DIRECT
LncBasev2
MEG3
hsa-miR-518b
IP

Gene Details
Chromosome: 14
Transcript: ENST00000522771
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-518b
Sequence: caaagcgcuccccuuuagaggu
MirBase ID: MIMAT0002844
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:100830898-100830926
exon
HITS-CLIP
DIRECT
LncBasev2
14:100829733-100829761
exon
HITS-CLIP
DIRECT
LncBasev2
MEG3
hsa-miR-518b
IP

Gene Details
Chromosome: 14
Transcript: NR_046467.1
Biotype: lincRNA
Gene id: NR_046467.1 (gene)
Gene Name: MEG3
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-518b
Sequence: caaagcgcuccccuuuagaggu
MirBase ID: MIMAT0002844
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:100829733-100829761
exon
HITS-CLIP
DIRECT
LncBasev2
MIA-RAB4B
hsa-miR-518b
IP

Gene Details
Chromosome: 19
Transcript: NR_037775.1
Biotype: sense
Gene id: NR_037775.1 (gene)
Gene Name: MIA-RAB4B
UCSC graphic: -
Expression:
  Cell Line Tissue Category
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-518b
Sequence: caaagcgcuccccuuuagaggu
MirBase ID: MIMAT0002844
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:40796677-40796705
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-518b
IP

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-518b
Sequence: caaagcgcuccccuuuagaggu
MirBase ID: MIMAT0002844
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65429405-65429433
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425206-65425234
exon
HITS-CLIP
DIRECT
LncBasev2
11:65443972-65444000
exon
HITS-CLIP
DIRECT
LncBasev2
11:65434739-65434767
exon
HITS-CLIP
DIRECT
LncBasev2
11:65440384-65440412
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-518b
IP

Gene Details
Chromosome: 11
Transcript: NR_028272.1
Biotype: lincRNA
Gene id: NR_028272.1 (gene)
Gene Name: NEAT1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-518b
Sequence: caaagcgcuccccuuuagaggu
MirBase ID: MIMAT0002844
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65425206-65425234
exon
HITS-CLIP
DIRECT
LncBasev2
PINK1-AS
hsa-miR-518b
IP

Gene Details
Chromosome: 1
Transcript: ENST00000451424
Biotype: antisense
Gene id: ENSG00000117242
Gene Name: PINK1-AS
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-518b
Sequence: caaagcgcuccccuuuagaggu
MirBase ID: MIMAT0002844
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:20652084-20652112
exon
HITS-CLIP
DIRECT
LncBasev2
PINK1-AS
hsa-miR-518b
-
IP

Gene Details
Chromosome: 1
Transcript: NR_046507.1
Biotype: antisense
Gene id: NR_046507.1 (gene)
Gene Name: PINK1-AS
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-miR-518b
Sequence: caaagcgcuccccuuuagaggu
MirBase ID: MIMAT0002844
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:20652084-20652112
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-104D3.2
hsa-miR-518b
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000430498
Biotype: processed_pseudogene
Gene id: ENSG00000236468
Gene Name: RP11-104D3.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-518b
Sequence: caaagcgcuccccuuuagaggu
MirBase ID: MIMAT0002844
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:199387955-199387983
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-466P24.2
hsa-miR-518b
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000506621
Biotype: processed_pseudogene
Gene id: ENSG00000254893
Gene Name: RP11-466P24.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-518b
Sequence: caaagcgcuccccuuuagaggu
MirBase ID: MIMAT0002844
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:76174127-76174155
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-531A24.3
hsa-miR-518b
IP

Gene Details
Chromosome: 8
Transcript: ENST00000564832
Biotype: lincRNA
Gene id: ENSG00000260838
Gene Name: RP11-531A24.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-518b
Sequence: caaagcgcuccccuuuagaggu
MirBase ID: MIMAT0002844
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:72948553-72948581
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-61J19.5
hsa-miR-518b
IP

Gene Details
Chromosome: 1
Transcript: ENST00000564287
Biotype: lincRNA
Gene id: ENSG00000260805
Gene Name: RP11-61J19.5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-518b
Sequence: caaagcgcuccccuuuagaggu
MirBase ID: MIMAT0002844
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:212558177-212558205
exon
HITS-CLIP
DIRECT
LncBasev2
RPL4P4
hsa-miR-518b
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000422486
Biotype: processed_pseudogene
Gene id: ENSG00000229638
Gene Name: RPL4P4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-518b
Sequence: caaagcgcuccccuuuagaggu
MirBase ID: MIMAT0002844
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:185417871-185417899
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: