Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-548q

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
LINC00341
hsa-miR-548q
IP

Gene Details
Chromosome: 14
Transcript: NR_026779.1
Biotype: sense
Gene id: NR_026779.1 (gene)
Gene Name: LINC00341
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-548q
Sequence: gcuggugcaaaaguaauggcgg
MirBase ID: MIMAT0011163
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBACD1
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:95408286-95408314
exon
PAR-CLIP
DIRECT
LncBasev2
RP3-412A9.17
hsa-miR-548q
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623789
Biotype: sense_overlapping
Gene id: ENSG00000278920
Gene Name: RP3-412A9.17
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-548q
Sequence: gcuggugcaaaaguaauggcgg
MirBase ID: MIMAT0011163
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCL35
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:31061458-31061486
exon
PAR-CLIP
DIRECT
LncBasev2
Funded by: