Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-5582-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC010983.1
hsa-miR-5582-3p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000418387
Biotype: lincRNA
Gene id: ENSG00000235056
Gene Name: AC010983.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-5582-3p
Sequence: uaaaacuuuaagugugccuagg
MirBase ID: MIMAT0022280
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
2:195004411-195004439
exon
HITS-CLIP
DIRECT
LncBasev2
AC012501.1
hsa-miR-5582-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000397284
Biotype: processed_pseudogene
Gene id: ENSG00000214024
Gene Name: AC012501.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-5582-3p
Sequence: uaaaacuuuaagugugccuagg
MirBase ID: MIMAT0022280
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
2:153370918-153370946
exon
HITS-CLIP
DIRECT
LncBasev2
AC013733.4
hsa-miR-5582-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000449835
Biotype: lincRNA
Gene id: ENSG00000225570
Gene Name: AC013733.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary

miRNA Details
Name: hsa-miR-5582-3p
Sequence: uaaaacuuuaagugugccuagg
MirBase ID: MIMAT0022280
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
2:181693348-181693376
exon
HITS-CLIP
DIRECT
LncBasev2
C1orf132
hsa-miR-5582-3p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000608023
Biotype: lincRNA
Gene id: ENSG00000203709
Gene Name: C1orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-5582-3p
Sequence: uaaaacuuuaagugugccuagg
MirBase ID: MIMAT0022280
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
1:207809685-207809713
exon
HITS-CLIP
DIRECT
LncBasev2
CECR7
hsa-miR-5582-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000441006
Biotype: lincRNA
Gene id: ENSG00000237438
Gene Name: CECR7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-5582-3p
Sequence: uaaaacuuuaagugugccuagg
MirBase ID: MIMAT0022280
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
22:17058716-17058744
exon
HITS-CLIP
DIRECT
LncBasev2
chr22-38_28785274-29006793.1
hsa-miR-5582-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-5582-3p
Sequence: uaaaacuuuaagugugccuagg
MirBase ID: MIMAT0022280
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
22:28983792-28983820
exon
HITS-CLIP
DIRECT
LncBasev2
CRHR1-IT1
hsa-miR-5582-3p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000455565
Biotype: processed_transcript
Gene id: ENSG00000204650
Gene Name: CRHR1-IT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-5582-3p
Sequence: uaaaacuuuaagugugccuagg
MirBase ID: MIMAT0022280
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
17:45637885-45637913
exon
HITS-CLIP
DIRECT
LncBasev2
HAGLR
hsa-miR-5582-3p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000416928
Biotype: antisense
Gene id: ENSG00000224189
Gene Name: HAGLR
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-5582-3p
Sequence: uaaaacuuuaagugugccuagg
MirBase ID: MIMAT0022280
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
2:176177304-176177332
exon
HITS-CLIP
DIRECT
LncBasev2
KCNQ1OT1
hsa-miR-5582-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-5582-3p
Sequence: uaaaacuuuaagugugccuagg
MirBase ID: MIMAT0022280
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
11:2650645-2650673
exon
HITS-CLIP
DIRECT
LncBasev2
LINC01004
hsa-miR-5582-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000445184
Biotype: antisense
Gene id: ENSG00000228393
Gene Name: LINC01004
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-5582-3p
Sequence: uaaaacuuuaagugugccuagg
MirBase ID: MIMAT0022280
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:104982107-104982135
exon
HITS-CLIP
DIRECT
LncBasev2
LINC01004
hsa-miR-5582-3p
IP

Gene Details
Chromosome: 7
Transcript: NR_039981.2
Biotype: lincRNA
Gene id: NR_039981.2 (gene)
Gene Name: LINC01004
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-5582-3p
Sequence: uaaaacuuuaagugugccuagg
MirBase ID: MIMAT0022280
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:104982107-104982135
exon
HITS-CLIP
DIRECT
LncBasev2
LINC01515
hsa-miR-5582-3p
IP

Gene Details
Chromosome: 10
Transcript: ENST00000433152
Biotype: lincRNA
Gene id: ENSG00000228065
Gene Name: LINC01515
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-5582-3p
Sequence: uaaaacuuuaagugugccuagg
MirBase ID: MIMAT0022280
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
10:65571494-65571522
exon
HITS-CLIP
DIRECT
LncBasev2
LUCAT1
hsa-miR-5582-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000513626
Biotype: lincRNA
Gene id: ENSG00000248323
Gene Name: LUCAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-5582-3p
Sequence: uaaaacuuuaagugugccuagg
MirBase ID: MIMAT0022280
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
5:91311152-91311180
exon
HITS-CLIP
DIRECT
LncBasev2
MAGI2-AS3
hsa-miR-5582-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000452320
Biotype: retained_intron
Gene id: ENSG00000234456
Gene Name: MAGI2-AS3
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-5582-3p
Sequence: uaaaacuuuaagugugccuagg
MirBase ID: MIMAT0022280
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
7:79459825-79459853
exon
HITS-CLIP
DIRECT
LncBasev2
MALAT1
hsa-miR-5582-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000534336
Biotype: lincRNA
Gene id: ENSG00000251562
Gene Name: MALAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-5582-3p
Sequence: uaaaacuuuaagugugccuagg
MirBase ID: MIMAT0022280
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
11:65501780-65501835
exon
HITS-CLIP
DIRECT
LncBasev2
11:65502003-65502031
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504086-65504114
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501192-65501220
exon
HITS-CLIP
DIRECT
LncBasev2
11:65499092-65499120
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501780-65501808
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504515-65504543
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504086-65504114
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501192-65501220
exon
HITS-CLIP
DIRECT
LncBasev2
11:65506005-65506033
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504515-65504543
exon
HITS-CLIP
DIRECT
LncBasev2
11:65506005-65506033
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504086-65504114
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501102-65501130
exon
HITS-CLIP
DIRECT
LncBasev2
11:65499092-65499120
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501780-65501835
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504086-65504114
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504515-65504543
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501938-65501966
exon
HITS-CLIP
DIRECT
LncBasev2
11:65502003-65502031
exon
HITS-CLIP
DIRECT
LncBasev2
11:65506005-65506033
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501192-65501220
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501780-65501808
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501938-65501966
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501780-65501835
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504086-65504114
exon
HITS-CLIP
DIRECT
LncBasev2
11:65499092-65499120
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501192-65501220
exon
HITS-CLIP
DIRECT
LncBasev2
11:65502003-65502031
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501102-65501130
exon
HITS-CLIP
DIRECT
LncBasev2
11:65506005-65506033
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504515-65504543
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504515-65504543
exon
HITS-CLIP
DIRECT
LncBasev2
11:65506005-65506033
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-5582-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-5582-3p
Sequence: uaaaacuuuaagugugccuagg
MirBase ID: MIMAT0022280
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
11:65425271-65425299
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424339-65424367
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425271-65425299
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424294-65424322
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424339-65424367
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425271-65425299
exon
HITS-CLIP
DIRECT
LncBasev2
11:65427196-65427224
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425271-65425299
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424294-65424322
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424339-65424367
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424339-65424367
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424294-65424322
exon
HITS-CLIP
DIRECT
LncBasev2
11:65427196-65427224
exon
HITS-CLIP
DIRECT
LncBasev2
11:65431464-65431492
exon
HITS-CLIP
DIRECT
LncBasev2
11:65440082-65440110
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-5582-3p
IP

Gene Details
Chromosome: 11
Transcript: NR_028272.1
Biotype: lincRNA
Gene id: NR_028272.1 (gene)
Gene Name: NEAT1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-5582-3p
Sequence: uaaaacuuuaagugugccuagg
MirBase ID: MIMAT0022280
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
11:65424339-65424367
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424294-65424322
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425271-65425299
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424339-65424367
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425271-65425299
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424339-65424367
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424294-65424322
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424294-65424322
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424339-65424367
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425271-65425299
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425271-65425299
exon
HITS-CLIP
DIRECT
LncBasev2
OIP5-AS1
hsa-miR-5582-3p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000500949
Biotype: antisense
Gene id: ENSG00000247556
Gene Name: OIP5-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-5582-3p
Sequence: uaaaacuuuaagugugccuagg
MirBase ID: MIMAT0022280
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
15:41300593-41300621
exon
HITS-CLIP
DIRECT
LncBasev2
15:41300593-41300621
exon
HITS-CLIP
DIRECT
LncBasev2
PPIAP19
hsa-miR-5582-3p
-
IP

Gene Details
Chromosome: 10
Transcript: ENST00000486414
Biotype: processed_pseudogene
Gene id: ENSG00000228169
Gene Name: PPIAP19
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-5582-3p
Sequence: uaaaacuuuaagugugccuagg
MirBase ID: MIMAT0022280
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
10:114690126-114690154
exon
HITS-CLIP
DIRECT
LncBasev2
RBFADN
hsa-miR-5582-3p
IP

Gene Details
Chromosome: 18
Transcript: ENST00000568911
Biotype: lincRNA
Gene id: ENSG00000261126
Gene Name: RBFADN
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-5582-3p
Sequence: uaaaacuuuaagugugccuagg
MirBase ID: MIMAT0022280
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
18:80063229-80063257
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: