Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-642a-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC004158.2
hsa-miR-642a-5p
-
IP

Gene Details
Chromosome: 16
Transcript: ENST00000570152
Biotype: lincRNA
Gene id: ENSG00000261008
Gene Name: AC004158.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-642a-5p
Sequence: gucccucuccaaaugugucuug
MirBase ID: MIMAT0003312
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
16:72617485-72617513
exon
HITS-CLIP
DIRECT
LncBasev2
AC018766.4
hsa-miR-642a-5p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000596624
Biotype: antisense
Gene id: ENSG00000267896
Gene Name: AC018766.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-642a-5p
Sequence: gucccucuccaaaugugucuug
MirBase ID: MIMAT0003312
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
19:49860215-49860243
exon
HITS-CLIP
DIRECT
LncBasev2
ANP32A-IT1
hsa-miR-642a-5p
IP

Gene Details
Chromosome: 15
Transcript: NR_026808.1
Biotype: sense
Gene id: NR_026808.1 (gene)
Gene Name: ANP32A-IT1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-642a-5p
Sequence: gucccucuccaaaugugucuug
MirBase ID: MIMAT0003312
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
15:68806249-68806277
exon
HITS-CLIP
DIRECT
LncBasev2
AP000320.7
hsa-miR-642a-5p
IP

Gene Details
Chromosome: 21
Transcript: ENST00000362077
Biotype: processed_transcript
Gene id: ENSG00000272657
Gene Name: AP000320.7
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-642a-5p
Sequence: gucccucuccaaaugugucuug
MirBase ID: MIMAT0003312
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
21:34125381-34125409
exon
HITS-CLIP
DIRECT
LncBasev2
AP000347.2
hsa-miR-642a-5p
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000417194
Biotype: processed_transcript
Gene id: ENSG00000272578
Gene Name: AP000347.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-642a-5p
Sequence: gucccucuccaaaugugucuug
MirBase ID: MIMAT0003312
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:23690958-23690986
exon
HITS-CLIP
DIRECT
LncBasev2
22:23691349-23691377
exon
HITS-CLIP
DIRECT
LncBasev2
CCDC183-AS1
hsa-miR-642a-5p
IP

Gene Details
Chromosome: 9
Transcript: ENST00000414656
Biotype: antisense
Gene id: ENSG00000228544
Gene Name: CCDC183-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-642a-5p
Sequence: gucccucuccaaaugugucuug
MirBase ID: MIMAT0003312
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
9:136805176-136805204
exon
HITS-CLIP
DIRECT
LncBasev2
CROCCP2
hsa-miR-642a-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000362058
Biotype: retained_intron
Gene id: ENSG00000215908
Gene Name: CROCCP2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-642a-5p
Sequence: gucccucuccaaaugugucuug
MirBase ID: MIMAT0003312
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
1:16630637-16630665
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2006C1.2
hsa-miR-642a-5p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000589551
Biotype: antisense
Gene id: ENSG00000219665
Gene Name: CTD-2006C1.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-642a-5p
Sequence: gucccucuccaaaugugucuug
MirBase ID: MIMAT0003312
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
19:11990333-11990361
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-642a-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000606074
Biotype: retained_intron
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-642a-5p
Sequence: gucccucuccaaaugugucuug
MirBase ID: MIMAT0003312
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:478030-478058
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-642a-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000534918
Biotype: retained_intron
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-642a-5p
Sequence: gucccucuccaaaugugucuug
MirBase ID: MIMAT0003312
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
5:478480-478508
exon
HITS-CLIP
DIRECT
LncBasev2
5:478480-478508
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2349P21.5
hsa-miR-642a-5p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000581019
Biotype: lincRNA
Gene id: ENSG00000263603
Gene Name: CTD-2349P21.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-642a-5p
Sequence: gucccucuccaaaugugucuug
MirBase ID: MIMAT0003312
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:30730017-30730045
exon
HITS-CLIP
DIRECT
LncBasev2
ERI3-IT1
hsa-miR-642a-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000414156
Biotype: sense_intronic
Gene id: ENSG00000233602
Gene Name: ERI3-IT1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-642a-5p
Sequence: gucccucuccaaaugugucuug
MirBase ID: MIMAT0003312
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
1:44243675-44243703
exon
HITS-CLIP
DIRECT
LncBasev2
GAS5
hsa-miR-642a-5p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000451607
Biotype: lincRNA
Gene id: ENSG00000234741
Gene Name: GAS5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-642a-5p
Sequence: gucccucuccaaaugugucuug
MirBase ID: MIMAT0003312
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
1:173867714-173867742
exon
HITS-CLIP
DIRECT
LncBasev2
1:173867714-173867742
exon
HITS-CLIP
DIRECT
LncBasev2
1:173867714-173867742
exon
HITS-CLIP
DIRECT
LncBasev2
1:173867714-173867742
exon
HITS-CLIP
DIRECT
LncBasev2
1:173867714-173867742
exon
HITS-CLIP
DIRECT
LncBasev2
GUSBP11
hsa-miR-642a-5p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000455485
Biotype: processed_transcript
Gene id: ENSG00000228315
Gene Name: GUSBP11
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-642a-5p
Sequence: gucccucuccaaaugugucuug
MirBase ID: MIMAT0003312
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:23690958-23690986
exon
HITS-CLIP
DIRECT
LncBasev2
22:23691349-23691377
exon
HITS-CLIP
DIRECT
LncBasev2
KB-1460A1.5
hsa-miR-642a-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000565617
Biotype: lincRNA
Gene id: ENSG00000261087
Gene Name: KB-1460A1.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-642a-5p
Sequence: gucccucuccaaaugugucuug
MirBase ID: MIMAT0003312
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
8:101167611-101167639
exon
HITS-CLIP
DIRECT
LncBasev2
KCNQ1OT1
hsa-miR-642a-5p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-642a-5p
Sequence: gucccucuccaaaugugucuug
MirBase ID: MIMAT0003312
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
11:2693315-2693343
exon
HITS-CLIP
DIRECT
LncBasev2
11:2691992-2692020
exon
HITS-CLIP
DIRECT
LncBasev2
11:2681642-2681670
exon
HITS-CLIP
DIRECT
LncBasev2
11:2691992-2692020
exon
HITS-CLIP
DIRECT
LncBasev2
KDM4A-AS1
hsa-miR-642a-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000434346
Biotype: antisense
Gene id: ENSG00000236200
Gene Name: KDM4A-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-642a-5p
Sequence: gucccucuccaaaugugucuug
MirBase ID: MIMAT0003312
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
1:43702532-43702560
exon
HITS-CLIP
DIRECT
LncBasev2
LA16c-358B7.4
hsa-miR-642a-5p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000339021
Biotype: antisense
Gene id: ENSG00000274751
Gene Name: LA16c-358B7.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-642a-5p
Sequence: gucccucuccaaaugugucuug
MirBase ID: MIMAT0003312
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
16:1306829-1306857
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00235
hsa-miR-642a-5p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000622160
Biotype: lincRNA
Gene id: ENSG00000277142
Gene Name: LINC00235
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-642a-5p
Sequence: gucccucuccaaaugugucuug
MirBase ID: MIMAT0003312
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
16:525353-525381
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00657
hsa-miR-642a-5p
IP

Gene Details
Chromosome: 20
Transcript: ENST00000565493
Biotype: lincRNA
Gene id: ENSG00000260032
Gene Name: LINC00657
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-642a-5p
Sequence: gucccucuccaaaugugucuug
MirBase ID: MIMAT0003312
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
20:36049014-36049042
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: