Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-642b-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC116366.6
hsa-miR-642b-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000443093
Biotype: antisense
Gene id: ENSG00000234290
Gene Name: AC116366.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:132471450-132471478
exon
HITS-CLIP
DIRECT
LncBasev2
AL133243.2
hsa-miR-642b-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000617415
Biotype: sense_intronic
Gene id: ENSG00000276517
Gene Name: AL133243.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:32528049-32528077
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-134H23.2
hsa-miR-642b-3p
-
IP

Gene Details
Chromosome: 16
Transcript: ENST00000424293
Biotype: unprocessed_pseudogene
Gene id: ENSG00000196796
Gene Name: CTB-134H23.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:29052210-29052238
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-50E14.5
hsa-miR-642b-3p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000600255
Biotype: processed_pseudogene
Gene id: ENSG00000269374
Gene Name: CTB-50E14.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:42485442-42485470
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2006C1.2
hsa-miR-642b-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000489336
Biotype: antisense
Gene id: ENSG00000219665
Gene Name: CTD-2006C1.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:12003499-12003527
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2554C21.1
hsa-miR-642b-3p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000587765
Biotype: transcribed_processed_pseudogene
Gene id: ENSG00000267422
Gene Name: CTD-2554C21.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:37792051-37792079
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-3234P18.6
hsa-miR-642b-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000611182
Biotype: lincRNA
Gene id: ENSG00000276071
Gene Name: CTD-3234P18.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:36668779-36668807
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P13
hsa-miR-642b-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000503537
Biotype: processed_pseudogene
Gene id: ENSG00000250182
Gene Name: EEF1A1P13
UCSC graphic:
Expression:
  Cell Line Tissue Category
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:14652379-14652407
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P16
hsa-miR-642b-3p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000325349
Biotype: processed_pseudogene
Gene id: ENSG00000213235
Gene Name: EEF1A1P16
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:16991580-16991608
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P24
hsa-miR-642b-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000451469
Biotype: processed_pseudogene
Gene id: ENSG00000223668
Gene Name: EEF1A1P24
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:39359462-39359490
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P33
hsa-miR-642b-3p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000554413
Biotype: processed_pseudogene
Gene id: ENSG00000258846
Gene Name: EEF1A1P33
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:96901481-96901509
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P9
hsa-miR-642b-3p
-
IP

Gene Details
Chromosome: 4
Transcript: ENST00000514975
Biotype: processed_pseudogene
Gene id: ENSG00000249264
Gene Name: EEF1A1P9
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:105485611-105485639
exon
HITS-CLIP
DIRECT
LncBasev2
FAM35DP
hsa-miR-642b-3p
-
IP

Gene Details
Chromosome: 10
Transcript: ENST00000323387
Biotype: unprocessed_pseudogene
Gene id: ENSG00000189014
Gene Name: FAM35DP
UCSC graphic:
Expression:
  Cell Line Tissue Category
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:47710245-47710273
exon
HITS-CLIP
DIRECT
LncBasev2
FAM83H-AS1
hsa-miR-642b-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000533004
Biotype: lincRNA
Gene id: ENSG00000203499
Gene Name: FAM83H-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:143745221-143745249
exon
HITS-CLIP
DIRECT
LncBasev2
FLJ31356
hsa-miR-642b-3p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000445878
Biotype: antisense
Gene id: ENSG00000229951
Gene Name: FLJ31356
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:28384799-28384827
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00963
hsa-miR-642b-3p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000608669
Biotype: retained_intron
Gene id: ENSG00000204054
Gene Name: LINC00963
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:129502055-129502083
exon
HITS-CLIP
DIRECT
LncBasev2
LOC100128288
hsa-miR-642b-3p
IP

Gene Details
Chromosome: 17
Transcript: NR_024447.1
Biotype: lincRNA
Gene id: NR_024447.1 (gene)
Gene Name: LOC100128288
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:8359192-8359220
exon
HITS-CLIP
DIRECT
LncBasev2
MIR7-3HG
hsa-miR-642b-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000586721
Biotype: lincRNA
Gene id: ENSG00000176840
Gene Name: MIR7-3HG
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:4772294-4772322
exon
HITS-CLIP
DIRECT
LncBasev2
NACAP3
hsa-miR-642b-3p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000552100
Biotype: processed_pseudogene
Gene id: ENSG00000257210
Gene Name: NACAP3
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:93124133-93124161
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-642b-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65441966-65441994
exon
HITS-CLIP
DIRECT
LncBasev2
11:65439849-65439877
exon
HITS-CLIP
DIRECT
LncBasev2
11:65429439-65429467
exon
HITS-CLIP
DIRECT
LncBasev2
11:65435594-65435622
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: