Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-642b-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
ACVR2B-AS1
hsa-miR-642b-5p
IP

Gene Details
Chromosome: 3
Transcript: ENST00000441531
Biotype: antisense
Gene id: ENSG00000229589
Gene Name: ACVR2B-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-642b-5p
Sequence: gguucccucuccaaaugugucu
MirBase ID: MIMAT0022736
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:38451867-38451895
exon
HITS-CLIP
DIRECT
LncBasev2
CA5BP1
hsa-miR-642b-5p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000380331
Biotype: processed_transcript
Gene id: ENSG00000186312
Gene Name: CA5BP1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-642b-5p
Sequence: gguucccucuccaaaugugucu
MirBase ID: MIMAT0022736
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:15681004-15681032
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2007L18.5
hsa-miR-642b-5p
-
IP

Gene Details
Chromosome: 11
Transcript: ENST00000564469
Biotype: lincRNA
Gene id: ENSG00000260808
Gene Name: CTD-2007L18.5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-642b-5p
Sequence: gguucccucuccaaaugugucu
MirBase ID: MIMAT0022736
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBACD3
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:68616700-68616728
exon
PAR-CLIP
DIRECT
LncBasev2
CTD-3185P2.1
hsa-miR-642b-5p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000565387
Biotype: antisense
Gene id: ENSG00000261351
Gene Name: CTD-3185P2.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-642b-5p
Sequence: gguucccucuccaaaugugucu
MirBase ID: MIMAT0022736
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:66488814-66488842
exon
HITS-CLIP
DIRECT
LncBasev2
DNM3OS
hsa-miR-642b-5p
IP

Gene Details
Chromosome: 1
Transcript: NR_038397.2
Biotype: antisense
Gene id: NR_038397.2 (gene)
Gene Name: DNM3OS
UCSC graphic: -
Expression:
  Cell Line Tissue Category
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-642b-5p
Sequence: gguucccucuccaaaugugucu
MirBase ID: MIMAT0022736
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:172144320-172144348
exon
HITS-CLIP
DIRECT
LncBasev2
GAS5
hsa-miR-642b-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000431268
Biotype: retained_intron
Gene id: ENSG00000234741
Gene Name: GAS5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-642b-5p
Sequence: gguucccucuccaaaugugucu
MirBase ID: MIMAT0022736
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:173866610-173866638
exon
HITS-CLIP
DIRECT
LncBasev2
HNRNPA1P5
hsa-miR-642b-5p
-
IP

Gene Details
Chromosome: 15
Transcript: ENST00000558213
Biotype: processed_pseudogene
Gene id: ENSG00000259512
Gene Name: HNRNPA1P5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-642b-5p
Sequence: gguucccucuccaaaugugucu
MirBase ID: MIMAT0022736
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:67628078-67628106
exon
HITS-CLIP
DIRECT
LncBasev2
KCNQ1OT1
hsa-miR-642b-5p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-642b-5p
Sequence: gguucccucuccaaaugugucu
MirBase ID: MIMAT0022736
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:2635675-2635703
exon
HITS-CLIP
DIRECT
LncBasev2
11:2634077-2634105
exon
HITS-CLIP
DIRECT
LncBasev2
LOC100506639
hsa-miR-642b-5p
IP

Gene Details
Chromosome: 5
Transcript: NR_102752.1
Biotype: sense
Gene id: NR_102752.1 (gene)
Gene Name: LOC100506639
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-642b-5p
Sequence: gguucccucuccaaaugugucu
MirBase ID: MIMAT0022736
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:43067026-43067054
exon
HITS-CLIP
DIRECT
LncBasev2
MAGI2-AS3
hsa-miR-642b-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000452320
Biotype: retained_intron
Gene id: ENSG00000234456
Gene Name: MAGI2-AS3
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-642b-5p
Sequence: gguucccucuccaaaugugucu
MirBase ID: MIMAT0022736
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:79460164-79460192
exon
HITS-CLIP
DIRECT
LncBasev2
MALAT1
hsa-miR-642b-5p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000534336
Biotype: lincRNA
Gene id: ENSG00000251562
Gene Name: MALAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-642b-5p
Sequence: gguucccucuccaaaugugucu
MirBase ID: MIMAT0022736
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65499078-65499106
exon
HITS-CLIP
DIRECT
LncBasev2
MEG3
hsa-miR-642b-5p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000522771
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-642b-5p
Sequence: gguucccucuccaaaugugucu
MirBase ID: MIMAT0022736
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:100847949-100847977
exon
HITS-CLIP
DIRECT
LncBasev2
MEG3
hsa-miR-642b-5p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000452120
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-642b-5p
Sequence: gguucccucuccaaaugugucu
MirBase ID: MIMAT0022736
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:100833094-100833122
exon
HITS-CLIP
DIRECT
LncBasev2
MTND4P12
hsa-miR-642b-5p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000498999
Biotype: processed_pseudogene
Gene id: ENSG00000247627
Gene Name: MTND4P12
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-642b-5p
Sequence: gguucccucuccaaaugugucu
MirBase ID: MIMAT0022736
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:134927622-134927650
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-642b-5p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-642b-5p
Sequence: gguucccucuccaaaugugucu
MirBase ID: MIMAT0022736
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65436733-65436761
exon
HITS-CLIP
DIRECT
LncBasev2
11:65423040-65423068
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-642b-5p
IP

Gene Details
Chromosome: 11
Transcript: NR_028272.1
Biotype: lincRNA
Gene id: NR_028272.1 (gene)
Gene Name: NEAT1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-642b-5p
Sequence: gguucccucuccaaaugugucu
MirBase ID: MIMAT0022736
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65423040-65423068
exon
HITS-CLIP
DIRECT
LncBasev2
NNT-AS1
hsa-miR-642b-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000513560
Biotype: antisense
Gene id: ENSG00000248092
Gene Name: NNT-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-642b-5p
Sequence: gguucccucuccaaaugugucu
MirBase ID: MIMAT0022736
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:43572471-43572499
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-1033A18.1
hsa-miR-642b-5p
-
IP

Gene Details
Chromosome: 11
Transcript: ENST00000530115
Biotype: processed_pseudogene
Gene id: ENSG00000224411
Gene Name: RP11-1033A18.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-642b-5p
Sequence: gguucccucuccaaaugugucu
MirBase ID: MIMAT0022736
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:27891019-27891047
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-112J1.1
hsa-miR-642b-5p
-
IP

Gene Details
Chromosome: 14
Transcript: ENST00000480540
Biotype: processed_pseudogene
Gene id: ENSG00000213598
Gene Name: RP11-112J1.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-642b-5p
Sequence: gguucccucuccaaaugugucu
MirBase ID: MIMAT0022736
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:58794800-58794828
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-146N23.1
hsa-miR-642b-5p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000397390
Biotype: processed_pseudogene
Gene id: ENSG00000232176
Gene Name: RP11-146N23.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-642b-5p
Sequence: gguucccucuccaaaugugucu
MirBase ID: MIMAT0022736
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:19200878-19200906
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: