Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-708-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC104651.1
hsa-miR-708-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000446998
Biotype: processed_pseudogene
Gene id: ENSG00000236307
Gene Name: AC104651.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-708-3p
Sequence: caacuagacugugagcuucuag
MirBase ID: MIMAT0004927
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:111888581-111888609
exon
HITS-CLIP
DIRECT
LncBasev2
AFG3L1P
hsa-miR-708-3p
-
IP

Gene Details
Chromosome: 16
Transcript: ENST00000437774
Biotype: processed_transcript
Gene id: ENSG00000223959
Gene Name: AFG3L1P
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-708-3p
Sequence: caacuagacugugagcuucuag
MirBase ID: MIMAT0004927
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
16:89996489-89996517
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-89H12.4
hsa-miR-708-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499521
Biotype: retained_intron
Gene id: ENSG00000230551
Gene Name: CTB-89H12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-708-3p
Sequence: caacuagacugugagcuucuag
MirBase ID: MIMAT0004927
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
5:149498690-149498718
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149494808-149494836
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2014B16.1
hsa-miR-708-3p
-
IP

Gene Details
Chromosome: 14
Transcript: ENST00000555712
Biotype: processed_pseudogene
Gene id: ENSG00000258629
Gene Name: CTD-2014B16.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-708-3p
Sequence: caacuagacugugagcuucuag
MirBase ID: MIMAT0004927
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:65880871-65880899
exon
HITS-CLIP
DIRECT
LncBasev2
FGD5-AS1
hsa-miR-708-3p
IP

Gene Details
Chromosome: 3
Transcript: ENST00000424349
Biotype: antisense
Gene id: ENSG00000225733
Gene Name: FGD5-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-708-3p
Sequence: caacuagacugugagcuucuag
MirBase ID: MIMAT0004927
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
3:14943092-14943120
exon
HITS-CLIP
DIRECT
LncBasev2
KCNIP4-IT1
hsa-miR-708-3p
IP

Gene Details
Chromosome: 4
Transcript: NR_002813.1
Biotype: sense
Gene id: NR_002813.1 (gene)
Gene Name: KCNIP4-IT1
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-miR-708-3p
Sequence: caacuagacugugagcuucuag
MirBase ID: MIMAT0004927
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
4:21847460-21847488
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00229
hsa-miR-708-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000443783
Biotype: lincRNA
Gene id: ENSG00000234300
Gene Name: LINC00229
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-708-3p
Sequence: caacuagacugugagcuucuag
MirBase ID: MIMAT0004927
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
22:44622291-44622319
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00472
hsa-miR-708-3p
IP

Gene Details
Chromosome: 6
Transcript: ENST00000426635
Biotype: lincRNA
Gene id: ENSG00000233237
Gene Name: LINC00472
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lung Normal/Primary
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary

miRNA Details
Name: hsa-miR-708-3p
Sequence: caacuagacugugagcuucuag
MirBase ID: MIMAT0004927
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
6:71415285-71415313
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00657
hsa-miR-708-3p
IP

Gene Details
Chromosome: 20
Transcript: ENST00000565493
Biotype: lincRNA
Gene id: ENSG00000260032
Gene Name: LINC00657
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-708-3p
Sequence: caacuagacugugagcuucuag
MirBase ID: MIMAT0004927
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:36047636-36047664
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:36047636-36047664
exon
HITS-CLIP
DIRECT
LncBasev2
LOC286367
hsa-miR-708-3p
IP

Gene Details
Chromosome: 9
Transcript: NR_024011.1
Biotype: sense
Gene id: NR_024011.1 (gene)
Gene Name: LOC286367
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-708-3p
Sequence: caacuagacugugagcuucuag
MirBase ID: MIMAT0004927
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
9:104774410-104774438
exon
HITS-CLIP
DIRECT
LncBasev2
MALAT1
hsa-miR-708-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000534336
Biotype: lincRNA
Gene id: ENSG00000251562
Gene Name: MALAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-708-3p
Sequence: caacuagacugugagcuucuag
MirBase ID: MIMAT0004927
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
11:65504917-65504945
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504917-65504945
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501841-65501869
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501841-65501869
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504917-65504945
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501841-65501869
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504917-65504945
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501841-65501869
exon
HITS-CLIP
DIRECT
LncBasev2
11:65499423-65499451
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501897-65501925
exon
HITS-CLIP
DIRECT
LncBasev2
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65504917-65504945
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501841-65501869
exon
HITS-CLIP
DIRECT
LncBasev2
MEG3
hsa-miR-708-3p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000455531
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-708-3p
Sequence: caacuagacugugagcuucuag
MirBase ID: MIMAT0004927
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:100834481-100834509
exon
HITS-CLIP
DIRECT
LncBasev2
MEG3
hsa-miR-708-3p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000522771
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-708-3p
Sequence: caacuagacugugagcuucuag
MirBase ID: MIMAT0004927
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:100848322-100848350
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-708-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-708-3p
Sequence: caacuagacugugagcuucuag
MirBase ID: MIMAT0004927
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
11:65424684-65424712
exon
HITS-CLIP
DIRECT
LncBasev2
11:65422810-65422838
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424684-65424712
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424337-65424365
exon
HITS-CLIP
DIRECT
LncBasev2
11:65442927-65442955
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424337-65424365
exon
HITS-CLIP
DIRECT
LncBasev2
11:65422810-65422838
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424684-65424712
exon
HITS-CLIP
DIRECT
LncBasev2
11:65422810-65422838
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424337-65424365
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424684-65424712
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424684-65424712
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424337-65424365
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65422810-65422838
exon
HITS-CLIP
DIRECT
LncBasev2
11:65428719-65428747
exon
HITS-CLIP
DIRECT
LncBasev2
11:65429095-65429123
exon
HITS-CLIP
DIRECT
LncBasev2
11:65442927-65442955
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65437719-65437747
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424684-65424712
exon
HITS-CLIP
DIRECT
LncBasev2
11:65434817-65434845
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424337-65424365
exon
HITS-CLIP
DIRECT
LncBasev2
11:65428719-65428747
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424684-65424712
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-708-3p
IP

Gene Details
Chromosome: 11
Transcript: NR_028272.1
Biotype: lincRNA
Gene id: NR_028272.1 (gene)
Gene Name: NEAT1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-708-3p
Sequence: caacuagacugugagcuucuag
MirBase ID: MIMAT0004927
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
11:65424337-65424365
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424684-65424712
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424684-65424712
exon
HITS-CLIP
DIRECT
LncBasev2
11:65422810-65422838
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424337-65424365
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424684-65424712
exon
HITS-CLIP
DIRECT
LncBasev2
11:65422810-65422838
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424337-65424365
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424684-65424712
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424337-65424365
exon
HITS-CLIP
DIRECT
LncBasev2
11:65422810-65422838
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424684-65424712
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65422810-65422838
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65424337-65424365
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424684-65424712
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424684-65424712
exon
HITS-CLIP
DIRECT
LncBasev2
RALY-AS1
hsa-miR-708-3p
IP

Gene Details
Chromosome: 20
Transcript: ENST00000440595
Biotype: lincRNA
Gene id: ENSG00000228265
Gene Name: RALY-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-708-3p
Sequence: caacuagacugugagcuucuag
MirBase ID: MIMAT0004927
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:33992496-33992524
exon
HITS-CLIP
DIRECT
LncBasev2
RMRP
hsa-miR-708-3p
IP

Gene Details
Chromosome: 9
Transcript: ENST00000602361
Biotype: lincRNA
Gene id: ENSG00000269900
Gene Name: RMRP
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-708-3p
Sequence: caacuagacugugagcuucuag
MirBase ID: MIMAT0004927
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
9:35657808-35657836
exon
HITS-CLIP
DIRECT
LncBasev2
9:35657808-35657836
exon
HITS-CLIP
DIRECT
LncBasev2
9:35657808-35657836
exon
HITS-CLIP
DIRECT
LncBasev2
9:35657808-35657836
exon
HITS-CLIP
DIRECT
LncBasev2
9:35657808-35657836
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:35657808-35657836
exon
HITS-CLIP
DIRECT
LncBasev2
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:35657808-35657836
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-106M3.1
hsa-miR-708-3p
-
IP

Gene Details
Chromosome: 15
Transcript: ENST00000477007
Biotype: processed_pseudogene
Gene id: ENSG00000243007
Gene Name: RP11-106M3.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-708-3p
Sequence: caacuagacugugagcuucuag
MirBase ID: MIMAT0004927
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:72379216-72379244
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-356M20.1
hsa-miR-708-3p
-
IP

Gene Details
Chromosome: 15
Transcript: ENST00000557949
Biotype: processed_pseudogene
Gene id: ENSG00000259674
Gene Name: RP11-356M20.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-708-3p
Sequence: caacuagacugugagcuucuag
MirBase ID: MIMAT0004927
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
15:59407256-59407284
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-367G18.2
hsa-miR-708-3p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000402798
Biotype: processed_pseudogene
Gene id: ENSG00000218208
Gene Name: RP11-367G18.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-708-3p
Sequence: caacuagacugugagcuucuag
MirBase ID: MIMAT0004927
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:113581816-113581844
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: