Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-708-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC005300.5
hsa-miR-708-5p
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000428401
Biotype: processed_pseudogene
Gene id: ENSG00000236325
Gene Name: AC005300.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-708-5p
Sequence: aaggagcuuacaaucuagcuggg
MirBase ID: MIMAT0004926
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
22:17193110-17193138
exon
HITS-CLIP
DIRECT
LncBasev2
AC005562.1
hsa-miR-708-5p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000440026
Biotype: processed_transcript
Gene id: ENSG00000214719
Gene Name: AC005562.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-708-5p
Sequence: aaggagcuuacaaucuagcuggg
MirBase ID: MIMAT0004926
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:30633245-30633273
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:30633245-30633273
exon
HITS-CLIP
DIRECT
LncBasev2
AC010492.2
hsa-miR-708-5p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000450182
Biotype: processed_pseudogene
Gene id: ENSG00000235081
Gene Name: AC010492.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-708-5p
Sequence: aaggagcuuacaaucuagcuggg
MirBase ID: MIMAT0004926
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:54229108-54229136
exon
HITS-CLIP
DIRECT
LncBasev2
AC010980.2
hsa-miR-708-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000555502
Biotype: processed_transcript
Gene id: ENSG00000237732
Gene Name: AC010980.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-708-5p
Sequence: aaggagcuuacaaucuagcuggg
MirBase ID: MIMAT0004926
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:222318848-222318876
exon
HITS-CLIP
DIRECT
LncBasev2
AC011995.1
hsa-miR-708-5p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000452701
Biotype: lincRNA
Gene id: ENSG00000237720
Gene Name: AC011995.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary

miRNA Details
Name: hsa-miR-708-5p
Sequence: aaggagcuuacaaucuagcuggg
MirBase ID: MIMAT0004926
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:2834248-2834276
exon
HITS-CLIP
DIRECT
LncBasev2
AC012531.25
hsa-miR-708-5p
IP

Gene Details
Chromosome: 12
Transcript: ENST00000562848
Biotype: lincRNA
Gene id: ENSG00000260597
Gene Name: AC012531.25
UCSC graphic:
Expression:
  Cell Line Tissue Category
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-708-5p
Sequence: aaggagcuuacaaucuagcuggg
MirBase ID: MIMAT0004926
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
12:54022164-54022192
exon
HITS-CLIP
DIRECT
LncBasev2
AC019097.7
hsa-miR-708-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000424783
Biotype: processed_pseudogene
Gene id: ENSG00000231822
Gene Name: AC019097.7
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-708-5p
Sequence: aaggagcuuacaaucuagcuggg
MirBase ID: MIMAT0004926
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:99102233-99102261
exon
HITS-CLIP
DIRECT
LncBasev2
AC026271.5
hsa-miR-708-5p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000447794
Biotype: processed_pseudogene
Gene id: ENSG00000174977
Gene Name: AC026271.5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-708-5p
Sequence: aaggagcuuacaaucuagcuggg
MirBase ID: MIMAT0004926
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
17:18650441-18650469
exon
HITS-CLIP
DIRECT
LncBasev2
AC034220.3
hsa-miR-708-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000621103
Biotype: antisense
Gene id: ENSG00000233006
Gene Name: AC034220.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-708-5p
Sequence: aaggagcuuacaaucuagcuggg
MirBase ID: MIMAT0004926
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:132311901-132311929
exon
HITS-CLIP
DIRECT
LncBasev2
AC083843.3
hsa-miR-708-5p
-
IP

Gene Details
Chromosome: 8
Transcript: ENST00000519500
Biotype: lincRNA
Gene id: ENSG00000253433
Gene Name: AC083843.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-708-5p
Sequence: aaggagcuuacaaucuagcuggg
MirBase ID: MIMAT0004926
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
8:134838047-134838075
exon
HITS-CLIP
DIRECT
LncBasev2
AC090587.2
hsa-miR-708-5p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000507938
Biotype: sense_overlapping
Gene id: ENSG00000250404
Gene Name: AC090587.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-708-5p
Sequence: aaggagcuuacaaucuagcuggg
MirBase ID: MIMAT0004926
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
11:3817147-3817175
exon
HITS-CLIP
DIRECT
LncBasev2
AC093323.3
hsa-miR-708-5p
IP

Gene Details
Chromosome: 4
Transcript: ENST00000307533
Biotype: lincRNA
Gene id: ENSG00000170846
Gene Name: AC093323.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-708-5p
Sequence: aaggagcuuacaaucuagcuggg
MirBase ID: MIMAT0004926
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:6675420-6675448
exon
HITS-CLIP
DIRECT
LncBasev2
ACTBP1
hsa-miR-708-5p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000417985
Biotype: processed_pseudogene
Gene id: ENSG00000229145
Gene Name: ACTBP1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-708-5p
Sequence: aaggagcuuacaaucuagcuggg
MirBase ID: MIMAT0004926
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
X:46288434-46288462
exon
HITS-CLIP
DIRECT
LncBasev2
AHCTF1P1
hsa-miR-708-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000420969
Biotype: processed_pseudogene
Gene id: ENSG00000226121
Gene Name: AHCTF1P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-708-5p
Sequence: aaggagcuuacaaucuagcuggg
MirBase ID: MIMAT0004926
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:161506880-161506908
exon
HITS-CLIP
DIRECT
LncBasev2
AP000347.2
hsa-miR-708-5p
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000417194
Biotype: processed_transcript
Gene id: ENSG00000272578
Gene Name: AP000347.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-708-5p
Sequence: aaggagcuuacaaucuagcuggg
MirBase ID: MIMAT0004926
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:23691366-23691394
exon
HITS-CLIP
DIRECT
LncBasev2
AP000436.4
hsa-miR-708-5p
-
IP

Gene Details
Chromosome: 11
Transcript: ENST00000605239
Biotype: processed_pseudogene
Gene id: ENSG00000270775
Gene Name: AP000436.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-708-5p
Sequence: aaggagcuuacaaucuagcuggg
MirBase ID: MIMAT0004926
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
11:65026413-65026441
exon
HITS-CLIP
DIRECT
LncBasev2
AP001347.6
hsa-miR-708-5p
IP

Gene Details
Chromosome: 21
Transcript: ENST00000448463
Biotype: antisense
Gene id: ENSG00000224905
Gene Name: AP001347.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-708-5p
Sequence: aaggagcuuacaaucuagcuggg
MirBase ID: MIMAT0004926
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
21:14088621-14088649
exon
HITS-CLIP
DIRECT
LncBasev2
ARHGEF26-AS1
hsa-miR-708-5p
IP

Gene Details
Chromosome: 3
Transcript: ENST00000491862
Biotype: antisense
Gene id: ENSG00000243069
Gene Name: ARHGEF26-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-708-5p
Sequence: aaggagcuuacaaucuagcuggg
MirBase ID: MIMAT0004926
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:154025176-154025204
exon
HITS-CLIP
DIRECT
LncBasev2
BRD2-IT1
hsa-miR-708-5p
IP

Gene Details
Chromosome: 6
Transcript: ENST00000415875
Biotype: sense_intronic
Gene id: ENSG00000223837
Gene Name: BRD2-IT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-708-5p
Sequence: aaggagcuuacaaucuagcuggg
MirBase ID: MIMAT0004926
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
6:32970816-32970844
exon
HITS-CLIP
DIRECT
LncBasev2
C10orf85
hsa-miR-708-5p
IP

Gene Details
Chromosome: 10
Transcript: ENST00000369071
Biotype: lincRNA
Gene id: ENSG00000177234
Gene Name: C10orf85
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-708-5p
Sequence: aaggagcuuacaaucuagcuggg
MirBase ID: MIMAT0004926
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
10:120598879-120598907
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: