Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-920

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
CASC7
hsa-miR-920
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-920
Sequence: ggggagcuguggaagcagua
MirBase ID: MIMAT0004970
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140522716-140522752
exon
HITS-CLIP
DIRECT
LncBasev2
FLJ16779
hsa-miR-920
IP

Gene Details
Chromosome: 20
Transcript: ENST00000612722
Biotype: antisense
Gene id: ENSG00000275620
Gene Name: FLJ16779
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-920
Sequence: ggggagcuguggaagcagua
MirBase ID: MIMAT0004970
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:63254546-63254574
exon
HITS-CLIP
DIRECT
LncBasev2
20:63254546-63254574
exon
HITS-CLIP
DIRECT
LncBasev2
MALAT1
hsa-miR-920
IP

Gene Details
Chromosome: 11
Transcript: ENST00000534336
Biotype: lincRNA
Gene id: ENSG00000251562
Gene Name: MALAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-920
Sequence: ggggagcuguggaagcagua
MirBase ID: MIMAT0004970
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65505510-65505538
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504764-65504792
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505510-65505538
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504764-65504792
exon
HITS-CLIP
DIRECT
LncBasev2
MEG3
hsa-miR-920
IP

Gene Details
Chromosome: 14
Transcript: ENST00000522771
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-920
Sequence: ggggagcuguggaagcagua
MirBase ID: MIMAT0004970
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:100829275-100829303
exon
HITS-CLIP
DIRECT
LncBasev2
MEG3
hsa-miR-920
IP

Gene Details
Chromosome: 14
Transcript: NR_046467.1
Biotype: lincRNA
Gene id: NR_046467.1 (gene)
Gene Name: MEG3
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-920
Sequence: ggggagcuguggaagcagua
MirBase ID: MIMAT0004970
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:100829275-100829303
exon
HITS-CLIP
DIRECT
LncBasev2
MIR663AHG
hsa-miR-920
IP

Gene Details
Chromosome: 20
Transcript: ENST00000601079
Biotype: lincRNA
Gene id: ENSG00000227195
Gene Name: MIR663AHG
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
- Lung Normal/Primary
- Testes Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-920
Sequence: ggggagcuguggaagcagua
MirBase ID: MIMAT0004970
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:26209422-26209450
exon
HITS-CLIP
DIRECT
LncBasev2
20:26209422-26209450
exon
HITS-CLIP
DIRECT
LncBasev2
MTND4P12
hsa-miR-920
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000498999
Biotype: processed_pseudogene
Gene id: ENSG00000247627
Gene Name: MTND4P12
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-920
Sequence: ggggagcuguggaagcagua
MirBase ID: MIMAT0004970
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:134927560-134927592
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-920
IP

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-920
Sequence: ggggagcuguggaagcagua
MirBase ID: MIMAT0004970
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65430093-65430121
exon
HITS-CLIP
DIRECT
LncBasev2
PARD6G-AS1
hsa-miR-920
IP

Gene Details
Chromosome: 18
Transcript: ENST00000588226
Biotype: antisense
Gene id: ENSG00000267270
Gene Name: PARD6G-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-920
Sequence: ggggagcuguggaagcagua
MirBase ID: MIMAT0004970
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
18:80149063-80149091
exon
HITS-CLIP
DIRECT
LncBasev2
RMRP
hsa-miR-920
IP

Gene Details
Chromosome: 9
Transcript: ENST00000602361
Biotype: lincRNA
Gene id: ENSG00000269900
Gene Name: RMRP
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-920
Sequence: ggggagcuguggaagcagua
MirBase ID: MIMAT0004970
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:35657815-35657843
exon
HITS-CLIP
DIRECT
LncBasev2
RNPS1P1
hsa-miR-920
-
IP

Gene Details
Chromosome: 4
Transcript: ENST00000507437
Biotype: processed_pseudogene
Gene id: ENSG00000250896
Gene Name: RNPS1P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-920
Sequence: ggggagcuguggaagcagua
MirBase ID: MIMAT0004970
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:11372776-11372819
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-475C16.1
hsa-miR-920
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000492974
Biotype: processed_pseudogene
Gene id: ENSG00000218426
Gene Name: RP11-475C16.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-920
Sequence: ggggagcuguggaagcagua
MirBase ID: MIMAT0004970
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:153282436-153282464
exon
HITS-CLIP
DIRECT
LncBasev2
SNHG3
hsa-miR-920
IP

Gene Details
Chromosome: 1
Transcript: ENST00000437681
Biotype: retained_intron
Gene id: ENSG00000242125
Gene Name: SNHG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-920
Sequence: ggggagcuguggaagcagua
MirBase ID: MIMAT0004970
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:28507371-28507399
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: