Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-93-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC002075.4
hsa-miR-93-5p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000425207
Biotype: processed_pseudogene
Gene id: ENSG00000237729
Gene Name: AC002075.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:93669816-93669844
exon
HITS-CLIP
DIRECT
LncBasev2
AC005154.6
hsa-miR-93-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000581794
Biotype: retained_intron
Gene id: ENSG00000196295
Gene Name: AC005154.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30567906-30567934
exon
HITS-CLIP
DIRECT
LncBasev2
AC006548.28
hsa-miR-93-5p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623130
Biotype: sense_overlapping
Gene id: ENSG00000280156
Gene Name: AC006548.28
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
22:16991133-16991161
exon
HITS-CLIP
DIRECT
LncBasev2
AC007036.5
hsa-miR-93-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000511893
Biotype: sense_overlapping
Gene id: ENSG00000251660
Gene Name: AC007036.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30159340-30159368
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30159116-30159144
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30159340-30159368
exon
HITS-CLIP
DIRECT
LncBasev2
AC007899.3
hsa-miR-93-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000412776
Biotype: processed_pseudogene
Gene id: ENSG00000224891
Gene Name: AC007899.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBACD1
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:37148649-37148677
exon
PAR-CLIP
DIRECT
LncBasev2
AC010492.2
hsa-miR-93-5p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000450182
Biotype: processed_pseudogene
Gene id: ENSG00000235081
Gene Name: AC010492.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:54229100-54229128
exon
HITS-CLIP
DIRECT
LncBasev2
AC027612.4
hsa-miR-93-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000445234
Biotype: unprocessed_pseudogene
Gene id: ENSG00000223703
Gene Name: AC027612.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: TZMBL
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:91737043-91737071
exon
HITS-CLIP
DIRECT
LncBasev2
AC084082.3
hsa-miR-93-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000517961
Biotype: lincRNA
Gene id: ENSG00000253190
Gene Name: AC084082.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: EF3DAGO2
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:66114630-66114658
exon
PAR-CLIP
DIRECT
LncBasev2
8:66114630-66114658
exon
PAR-CLIP
DIRECT
LncBasev2
8:66114630-66114658
exon
PAR-CLIP
DIRECT
LncBasev2
AC091492.2
hsa-miR-93-5p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000419844
Biotype: processed_pseudogene
Gene id: ENSG00000225026
Gene Name: AC091492.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
hMSC-BM Bone Marrow Stem/Progenitor
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:12328043-12328071
exon
HITS-CLIP
DIRECT
LncBasev2
AC091878.1
hsa-miR-93-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000399760
Biotype: antisense
Gene id: ENSG00000215196
Gene Name: AC091878.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:17216370-17216398
exon
HITS-CLIP
DIRECT
LncBasev2
5:17216439-17216467
exon
HITS-CLIP
DIRECT
LncBasev2
AC096772.6
hsa-miR-93-5p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000343987
Biotype: lincRNA
Gene id: ENSG00000244567
Gene Name: AC096772.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:207821555-207821583
exon
HITS-CLIP
DIRECT
LncBasev2
ADAMTSL4-AS1
hsa-miR-93-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000615012
Biotype: retained_intron
Gene id: ENSG00000203804
Gene Name: ADAMTSL4-AS1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
MDAMB231
IP
Tested Cell Line: MDAMB231
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:150560342-150560370
exon
HITS-CLIP
DIRECT
LncBasev2
1:150560342-150560370
exon
HITS-CLIP
DIRECT
LncBasev2
AF127936.7
hsa-miR-93-5p
IP

Gene Details
Chromosome: 21
Transcript: ENST00000432230
Biotype: lincRNA
Gene id: ENSG00000235609
Gene Name: AF127936.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
21:14822272-14822300
exon
HITS-CLIP
DIRECT
LncBasev2
AL133243.2
hsa-miR-93-5p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000617415
Biotype: sense_intronic
Gene id: ENSG00000276517
Gene Name: AL133243.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
2:32527623-32527651
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:32527425-32527453
exon
HITS-CLIP
DIRECT
LncBasev2
ANXA2P2
hsa-miR-93-5p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000435128
Biotype: processed_pseudogene
Gene id: ENSG00000231991
Gene Name: ANXA2P2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:33624345-33624373
exon
HITS-CLIP
DIRECT
LncBasev2
ARRDC1-AS1
hsa-miR-93-5p
IP

Gene Details
Chromosome: 9
Transcript: ENST00000623970
Biotype: antisense
Gene id: ENSG00000203993
Gene Name: ARRDC1-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:137618630-137618658
exon
HITS-CLIP
DIRECT
LncBasev2
ATP8B5P
hsa-miR-93-5p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000430846
Biotype: processed_transcript
Gene id: ENSG00000179766
Gene Name: ATP8B5P
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:35449991-35450019
exon
HITS-CLIP
DIRECT
LncBasev2
BLOC1S5-TXNDC5
hsa-miR-93-5p
IP

Gene Details
Chromosome: 6
Transcript: NR_037616.1
Biotype: sense
Gene id: NR_037616.1 (gene)
Gene Name: BLOC1S5-TXNDC5
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
6:7891725-7891753
exon
HITS-CLIP
DIRECT
LncBasev2
BRD7P4
hsa-miR-93-5p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000406170
Biotype: processed_pseudogene
Gene id: ENSG00000218676
Gene Name: BRD7P4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:111430950-111430978
exon
HITS-CLIP
DIRECT
LncBasev2
BZRAP1-AS1
hsa-miR-93-5p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000580022
Biotype: antisense
Gene id: ENSG00000265148
Gene Name: BZRAP1-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: EF3DAGO2
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:58353252-58353280
exon
PAR-CLIP
DIRECT
LncBasev2
Funded by: