Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-935

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC003092.1
hsa-miR-935
IP

Gene Details
Chromosome: 7
Transcript: ENST00000415536
Biotype: lincRNA
Gene id: ENSG00000236453
Gene Name: AC003092.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-935
Sequence: ccaguuaccgcuuccgcuaccgc
MirBase ID: MIMAT0004978
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:94064656-94064684
exon
HITS-CLIP
DIRECT
LncBasev2
BLOC1S5-TXNDC5
hsa-miR-935
IP

Gene Details
Chromosome: 6
Transcript: NR_037616.1
Biotype: sense
Gene id: NR_037616.1 (gene)
Gene Name: BLOC1S5-TXNDC5
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-935
Sequence: ccaguuaccgcuuccgcuaccgc
MirBase ID: MIMAT0004978
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:7899606-7899634
exon
HITS-CLIP
DIRECT
LncBasev2
CACTIN-AS1
hsa-miR-935
IP

Gene Details
Chromosome: 19
Transcript: ENST00000592274
Biotype: antisense
Gene id: ENSG00000226800
Gene Name: CACTIN-AS1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-935
Sequence: ccaguuaccgcuuccgcuaccgc
MirBase ID: MIMAT0004978
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
19:3611958-3611986
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-89H12.4
hsa-miR-935
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499521
Biotype: retained_intron
Gene id: ENSG00000230551
Gene Name: CTB-89H12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-935
Sequence: ccaguuaccgcuuccgcuaccgc
MirBase ID: MIMAT0004978
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149496636-149496664
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-329H14.1
hsa-miR-935
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000506742
Biotype: processed_pseudogene
Gene id: ENSG00000249921
Gene Name: CTC-329H14.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-935
Sequence: ccaguuaccgcuuccgcuaccgc
MirBase ID: MIMAT0004978
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:108785121-108785149
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.1
hsa-miR-935
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000509301
Biotype: processed_pseudogene
Gene id: ENSG00000250645
Gene Name: CTD-2228K2.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-935
Sequence: ccaguuaccgcuuccgcuaccgc
MirBase ID: MIMAT0004978
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:418730-418758
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-935
IP

Gene Details
Chromosome: 5
Transcript: ENST00000534918
Biotype: retained_intron
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-935
Sequence: ccaguuaccgcuuccgcuaccgc
MirBase ID: MIMAT0004978
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
5:478317-478345
exon
HITS-CLIP
DIRECT
LncBasev2
EIF4A1P10
hsa-miR-935
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000428832
Biotype: processed_pseudogene
Gene id: ENSG00000229132
Gene Name: EIF4A1P10
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-935
Sequence: ccaguuaccgcuuccgcuaccgc
MirBase ID: MIMAT0004978
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:92114381-92114409
exon
HITS-CLIP
DIRECT
LncBasev2
ENO1P1
hsa-miR-935
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000366587
Biotype: transcribed_processed_pseudogene
Gene id: ENSG00000244457
Gene Name: ENO1P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-935
Sequence: ccaguuaccgcuuccgcuaccgc
MirBase ID: MIMAT0004978
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:236483261-236483289
exon
HITS-CLIP
DIRECT
LncBasev2
FAM211A-AS1
hsa-miR-935
IP

Gene Details
Chromosome: 17
Transcript: NR_045026.1
Biotype: lincRNA
Gene id: NR_045026.1 (gene)
Gene Name: FAM211A-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-935
Sequence: ccaguuaccgcuuccgcuaccgc
MirBase ID: MIMAT0004978
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:16439525-16439553
exon
HITS-CLIP
DIRECT
LncBasev2
FAR1-IT1
hsa-miR-935
IP

Gene Details
Chromosome: 11
Transcript: ENST00000525233
Biotype: sense_intronic
Gene id: ENSG00000254791
Gene Name: FAR1-IT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-935
Sequence: ccaguuaccgcuuccgcuaccgc
MirBase ID: MIMAT0004978
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
11:13669370-13669398
exon
HITS-CLIP
DIRECT
LncBasev2
FLJ12825
hsa-miR-935
IP

Gene Details
Chromosome: 12
Transcript: ENST00000515617
Biotype: lincRNA
Gene id: ENSG00000248265
Gene Name: FLJ12825
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-935
Sequence: ccaguuaccgcuuccgcuaccgc
MirBase ID: MIMAT0004978
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
12:54120079-54120107
exon
HITS-CLIP
DIRECT
LncBasev2
GAS5
hsa-miR-935
IP

Gene Details
Chromosome: 1
Transcript: ENST00000431268
Biotype: retained_intron
Gene id: ENSG00000234741
Gene Name: GAS5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-935
Sequence: ccaguuaccgcuuccgcuaccgc
MirBase ID: MIMAT0004978
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
1:173866638-173866666
exon
HITS-CLIP
DIRECT
LncBasev2
GAS5
hsa-miR-935
IP

Gene Details
Chromosome: 1
Transcript: ENST00000421068
Biotype: retained_intron
Gene id: ENSG00000234741
Gene Name: GAS5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-935
Sequence: ccaguuaccgcuuccgcuaccgc
MirBase ID: MIMAT0004978
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
1:173865970-173865998
exon
HITS-CLIP
DIRECT
LncBasev2
1:173865970-173865998
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:173865970-173865998
exon
HITS-CLIP
DIRECT
LncBasev2
GJA9-MYCBP
hsa-miR-935
IP

Gene Details
Chromosome: 1
Transcript: NR_037633.1
Biotype: sense
Gene id: NR_037633.1 (gene)
Gene Name: GJA9-MYCBP
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-miR-935
Sequence: ccaguuaccgcuuccgcuaccgc
MirBase ID: MIMAT0004978
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
1:38866939-38866967
exon
HITS-CLIP
DIRECT
LncBasev2
HNRNPU-AS1
hsa-miR-935
IP

Gene Details
Chromosome: 1
Transcript: ENST00000366527
Biotype: antisense
Gene id: ENSG00000188206
Gene Name: HNRNPU-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-935
Sequence: ccaguuaccgcuuccgcuaccgc
MirBase ID: MIMAT0004978
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
1:244844221-244844249
exon
HITS-CLIP
DIRECT
LncBasev2
KCNQ1OT1
hsa-miR-935
IP

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-935
Sequence: ccaguuaccgcuuccgcuaccgc
MirBase ID: MIMAT0004978
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
11:2662543-2662571
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00473
hsa-miR-935
IP

Gene Details
Chromosome: 6
Transcript: ENST00000584911
Biotype: lincRNA
Gene id: ENSG00000223414
Gene Name: LINC00473
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-935
Sequence: ccaguuaccgcuuccgcuaccgc
MirBase ID: MIMAT0004978
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
6:165949183-165949211
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00657
hsa-miR-935
IP

Gene Details
Chromosome: 20
Transcript: ENST00000565493
Biotype: lincRNA
Gene id: ENSG00000260032
Gene Name: LINC00657
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-935
Sequence: ccaguuaccgcuuccgcuaccgc
MirBase ID: MIMAT0004978
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
20:36050864-36050892
exon
HITS-CLIP
DIRECT
LncBasev2
LRRC75A-AS1
hsa-miR-935
IP

Gene Details
Chromosome: 17
Transcript: ENST00000497774
Biotype: retained_intron
Gene id: ENSG00000175061
Gene Name: LRRC75A-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-935
Sequence: ccaguuaccgcuuccgcuaccgc
MirBase ID: MIMAT0004978
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:16440056-16440084
exon
HITS-CLIP
DIRECT
LncBasev2
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:16440056-16440084
exon
HITS-CLIP
DIRECT
LncBasev2
17:16439525-16439553
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: