Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-107
hsa-let-7a-5p
Clear all

XLOC_001148
XLOC_000992
XLOC_000647
XLOC_001602
Show allClear all
Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
XLOC_000647
hsa-let-7a-5p
IP

Gene Details
Chromosome: chr1
Transcript: TCONS_00002272
Biotype: transcript isomorph
Gene id: XLOC_000647
Gene Name: XLOC_000647
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
HREpiC Kidney Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-let-7a-5p
Sequence: ugagguaguagguuguauaguu
MirBase ID: MIMAT0000062
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
chr1:247333781-247333818
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: TZMBL
Category: Cancer/Malignant
Experimental Condition: shRNs against HIV-1
Location
Region
Method
Result
Validation Type
Source
chr1:247333790-247333818
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
chr1:247333822-247333850
exon
HITS-CLIP
DIRECT
LncBasev2
chr1:247333755-247333818
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_000992
hsa-let-7a-5p
IP

Gene Details
Chromosome: chr1
Transcript: TCONS_00001651
Biotype: transcript isomorph
Gene id: XLOC_000992
Gene Name: XLOC_000992
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
- Liver Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-let-7a-5p
Sequence: ugagguaguagguuguauaguu
MirBase ID: MIMAT0000062
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
chr1:121743412-121743440
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_001148
hsa-miR-107
IP

Gene Details
Chromosome: chr1
Transcript: TCONS_00000111
Biotype: transcript isomorph
Gene id: XLOC_001148
Gene Name: XLOC_001148
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
- Placenta Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-107
Sequence: agcagcauuguacagggcuauca
MirBase ID: MIMAT0000104
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
chr1:198899767-198899795
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_001602
hsa-let-7a-5p
IP

Gene Details
Chromosome: chr2
Transcript: TCONS_00002650
Biotype: transcript isomorph
Gene id: XLOC_001602
Gene Name: XLOC_001602
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary

miRNA Details
Name: hsa-let-7a-5p
Sequence: ugagguaguagguuguauaguu
MirBase ID: MIMAT0000062
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
chr2:104506029-104506057
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: