Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-29b-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
RP5-1074L1.4
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000609909
Biotype: antisense
Gene id: ENSG00000273373
Gene Name: RP5-1074L1.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:110372828-110372856
exon
HITS-CLIP
DIRECT
LncBasev2
RP5-890O3.9
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000444968
Biotype: sense_intronic
Gene id: ENSG00000240731
Gene Name: RP5-890O3.9
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:1317691-1317719
exon
HITS-CLIP
DIRECT
LncBasev2
RP6-24A23.7
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000564206
Biotype: sense_overlapping
Gene id: ENSG00000261409
Gene Name: RP6-24A23.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
X:108720279-108720307
exon
HITS-CLIP
DIRECT
LncBasev2
X:108720279-108720307
exon
HITS-CLIP
DIRECT
LncBasev2
X:108720279-108720307
exon
HITS-CLIP
DIRECT
LncBasev2
RPL18AP3
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000462885
Biotype: processed_pseudogene
Gene id: ENSG00000213442
Gene Name: RPL18AP3
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:104265609-104265637
exon
HITS-CLIP
DIRECT
LncBasev2
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:104265609-104265637
exon
HITS-CLIP
DIRECT
LncBasev2
RPL30P2
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000414021
Biotype: processed_pseudogene
Gene id: ENSG00000234272
Gene Name: RPL30P2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:152131704-152131732
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:152131704-152131732
exon
HITS-CLIP
DIRECT
LncBasev2
RPL3P4
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 14
Transcript: ENST00000417615
Biotype: processed_pseudogene
Gene id: ENSG00000232573
Gene Name: RPL3P4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:98973056-98973084
exon
HITS-CLIP
DIRECT
LncBasev2
RPL4P4
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000422486
Biotype: processed_pseudogene
Gene id: ENSG00000229638
Gene Name: RPL4P4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:185418505-185418533
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:185418505-185418533
exon
HITS-CLIP
DIRECT
LncBasev2
RPS27AP2
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 20
Transcript: ENST00000457576
Biotype: processed_pseudogene
Gene id: ENSG00000232333
Gene Name: RPS27AP2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:17517046-17517074
exon
HITS-CLIP
DIRECT
LncBasev2
RPS4XP13
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 11
Transcript: ENST00000483219
Biotype: processed_pseudogene
Gene id: ENSG00000240371
Gene Name: RPS4XP13
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:57576526-57576554
exon
HITS-CLIP
DIRECT
LncBasev2
RPS4XP19
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 18
Transcript: ENST00000460237
Biotype: processed_pseudogene
Gene id: ENSG00000242058
Gene Name: RPS4XP19
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
18:9020551-9020579
exon
HITS-CLIP
DIRECT
LncBasev2
RTN3P1
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 4
Transcript: ENST00000536295
Biotype: processed_pseudogene
Gene id: ENSG00000251333
Gene Name: RTN3P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:145376043-145376071
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:145376043-145376071
exon
HITS-CLIP
DIRECT
LncBasev2
SCART1
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 10
Transcript: ENST00000482993
Biotype: retained_intron
Gene id: ENSG00000214279
Gene Name: SCART1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
10:133458003-133458031
exon
HITS-CLIP
DIRECT
LncBasev2
SENP3-EIF4A1
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 17
Transcript: NR_037926.1
Biotype: sense
Gene id: NR_037926.1 (gene)
Gene Name: SENP3-EIF4A1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
17:7562068-7562096
exon
HITS-CLIP
DIRECT
LncBasev2
SEPT5-GP1BB
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 22
Transcript: NR_037611.1
Biotype: sense
Gene id: NR_037611.1 (gene)
Gene Name: SEPT5-GP1BB
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:19724723-19724751
exon
HITS-CLIP
DIRECT
LncBasev2
SLC2A3P1
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000519666
Biotype: processed_pseudogene
Gene id: ENSG00000253861
Gene Name: SLC2A3P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:168553491-168553519
exon
HITS-CLIP
DIRECT
LncBasev2
SLC2A3P2
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000331747
Biotype: processed_pseudogene
Gene id: ENSG00000185031
Gene Name: SLC2A3P2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:64985902-64985930
exon
HITS-CLIP
DIRECT
LncBasev2
SMURF2P1
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000579301
Biotype: processed_transcript
Gene id: ENSG00000248121
Gene Name: SMURF2P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HREpiC Kidney Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:30608475-30608503
exon
HITS-CLIP
DIRECT
LncBasev2
SNAI3-AS1
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000568633
Biotype: antisense
Gene id: ENSG00000260630
Gene Name: SNAI3-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
16:88674624-88674652
exon
HITS-CLIP
DIRECT
LncBasev2
SNHG14
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 15
Transcript: ENST00000557108
Biotype: retained_intron
Gene id: ENSG00000224078
Gene Name: SNHG14
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:24979401-24979429
exon
HITS-CLIP
DIRECT
LncBasev2
SNHG14
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000546682
Biotype: antisense
Gene id: ENSG00000224078
Gene Name: SNHG14
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:25111532-25111560
exon
HITS-CLIP
DIRECT
LncBasev2
15:25105023-25105051
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: