Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-29b-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
H19
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000414790
Biotype: lincRNA
Gene id: ENSG00000130600
Gene Name: H19
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
11:1997751-1997779
exon
HITS-CLIP
DIRECT
LncBasev2
H3F3AP6
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 4
Transcript: ENST00000230495
Biotype: processed_pseudogene
Gene id: ENSG00000178458
Gene Name: H3F3AP6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HMSC
Category: Stem/Progenitor
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:139698278-139698306
exon
HITS-CLIP
DIRECT
LncBasev2
HMBOX1-IT1
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000558292
Biotype: sense_intronic
Gene id: ENSG00000259196
Gene Name: HMBOX1-IT1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:28949789-28949817
exon
HITS-CLIP
DIRECT
LncBasev2
HMGA1P8
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000414130
Biotype: processed_pseudogene
Gene id: ENSG00000233155
Gene Name: HMGA1P8
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:74418235-74418263
exon
HITS-CLIP
DIRECT
LncBasev2
HMGB3P2
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 20
Transcript: ENST00000411913
Biotype: processed_pseudogene
Gene id: ENSG00000231470
Gene Name: HMGB3P2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
20:36076092-36076120
exon
HITS-CLIP
DIRECT
LncBasev2
HNRNPKP4
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000485383
Biotype: processed_pseudogene
Gene id: ENSG00000243547
Gene Name: HNRNPKP4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:96350021-96350049
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:96350021-96350049
exon
HITS-CLIP
DIRECT
LncBasev2
HNRNPU-AS1
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000366527
Biotype: antisense
Gene id: ENSG00000188206
Gene Name: HNRNPU-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:244842899-244842927
exon
HITS-CLIP
DIRECT
LncBasev2
HSPA9P1
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000432228
Biotype: processed_pseudogene
Gene id: ENSG00000226666
Gene Name: HSPA9P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:221961943-221961971
exon
HITS-CLIP
DIRECT
LncBasev2
HSPD1P1
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000503199
Biotype: processed_pseudogene
Gene id: ENSG00000213430
Gene Name: HSPD1P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:21882968-21882996
exon
HITS-CLIP
DIRECT
LncBasev2
HTR5AOS
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000395731
Biotype: antisense
Gene id: ENSG00000220575
Gene Name: HTR5AOS
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:155067972-155068000
exon
HITS-CLIP
DIRECT
LncBasev2
IPW
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 15
Transcript: NR_023915.1
Biotype: lincRNA
Gene id: NR_023915.1 (gene)
Gene Name: IPW
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:25116809-25116837
exon
HITS-CLIP
DIRECT
LncBasev2
KANTR
hsa-miR-29b-3p
IP

Gene Details
Chromosome: X
Transcript: ENST00000604849
Biotype: lincRNA
Gene id: ENSG00000232593
Gene Name: KANTR
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:53142949-53142977
exon
HITS-CLIP
DIRECT
LncBasev2
X:53142988-53143016
exon
HITS-CLIP
DIRECT
LncBasev2
KCNQ1OT1
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
11:2673823-2673851
exon
HITS-CLIP
DIRECT
LncBasev2
11:2691998-2692026
exon
HITS-CLIP
DIRECT
LncBasev2
11:2665355-2665383
exon
HITS-CLIP
DIRECT
LncBasev2
11:2691998-2692026
exon
HITS-CLIP
DIRECT
LncBasev2
KRT8P3
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 8
Transcript: ENST00000519669
Biotype: processed_pseudogene
Gene id: ENSG00000254285
Gene Name: KRT8P3
UCSC graphic:
Expression:
  Cell Line Tissue Category
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:61578929-61578957
exon
HITS-CLIP
DIRECT
LncBasev2
KRT8P36
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000489121
Biotype: processed_pseudogene
Gene id: ENSG00000240668
Gene Name: KRT8P36
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:138102179-138102207
exon
HITS-CLIP
DIRECT
LncBasev2
KRT8P45
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000414328
Biotype: processed_pseudogene
Gene id: ENSG00000224520
Gene Name: KRT8P45
UCSC graphic:
Expression:
  Cell Line Tissue Category
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:157073963-157073991
exon
HITS-CLIP
DIRECT
LncBasev2
LAP3P2
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000454686
Biotype: processed_pseudogene
Gene id: ENSG00000213500
Gene Name: LAP3P2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:36673989-36674017
exon
HITS-CLIP
DIRECT
LncBasev2
LDHAP4
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000397561
Biotype: processed_pseudogene
Gene id: ENSG00000214110
Gene Name: LDHAP4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:14922244-14922272
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00086
hsa-miR-29b-3p
IP

Gene Details
Chromosome: X
Transcript: ENST00000417443
Biotype: lincRNA
Gene id: ENSG00000178947
Gene Name: LINC00086
UCSC graphic:
Expression:
  Cell Line Tissue Category
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:135426555-135426583
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00263
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 10
Transcript: ENST00000454935
Biotype: lincRNA
Gene id: ENSG00000235823
Gene Name: LINC00263
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:100381287-100381315
exon
HITS-CLIP
DIRECT
LncBasev2
10:100383020-100383048
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: