Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-29b-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
LINC00263
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 10
Transcript: NR_026762.1
Biotype: lincRNA
Gene id: NR_026762.1 (gene)
Gene Name: LINC00263
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:100381287-100381315
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00338
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 17
Transcript: NR_027058.1
Biotype: sense
Gene id: NR_027058.1 (gene)
Gene Name: LINC00338
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:77094361-77094389
exon
HITS-CLIP
DIRECT
LncBasev2
17:77094326-77094354
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00461
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000505030
Biotype: lincRNA
Gene id: ENSG00000245526
Gene Name: LINC00461
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:88664758-88664786
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00511
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000457958
Biotype: lincRNA
Gene id: ENSG00000227036
Gene Name: LINC00511
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:72403607-72403635
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00632
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000498732
Biotype: lincRNA
Gene id: ENSG00000203930
Gene Name: LINC00632
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:140772611-140772639
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00657
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 20
Transcript: ENST00000565493
Biotype: lincRNA
Gene id: ENSG00000260032
Gene Name: LINC00657
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:36048399-36048427
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00674
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000620266
Biotype: lincRNA
Gene id: ENSG00000278730
Gene Name: LINC00674
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:68129536-68129564
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:68129536-68129564
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00888
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000482098
Biotype: retained_intron
Gene id: ENSG00000240024
Gene Name: LINC00888
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:183453887-183453915
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:183453887-183453915
exon
HITS-CLIP
DIRECT
LncBasev2
LINC01000
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 7
Transcript: NR_024368.1
Biotype: lincRNA
Gene id: NR_024368.1 (gene)
Gene Name: LINC01000
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
7:128641243-128641271
exon
HITS-CLIP
DIRECT
LncBasev2
LINC01109
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 8
Transcript: ENST00000603837
Biotype: lincRNA
Gene id: ENSG00000271167
Gene Name: LINC01109
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:76405060-76405088
exon
HITS-CLIP
DIRECT
LncBasev2
LINC01184
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000501702
Biotype: lincRNA
Gene id: ENSG00000245937
Gene Name: LINC01184
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:128021670-128021698
exon
HITS-CLIP
DIRECT
LncBasev2
LINC01184
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 5
Transcript: NR_015360.1
Biotype: lincRNA
Gene id: NR_015360.1 (gene)
Gene Name: LINC01184
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:128021670-128021698
exon
HITS-CLIP
DIRECT
LncBasev2
LINC01251
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 9
Transcript: ENST00000444956
Biotype: antisense
Gene id: ENSG00000233776
Gene Name: LINC01251
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:33732982-33733010
exon
HITS-CLIP
DIRECT
LncBasev2
LOC100129034
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 9
Transcript: NR_027406.1
Biotype: antisense
Gene id: NR_027406.1 (gene)
Gene Name: LOC100129034
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:124358993-124359021
exon
HITS-CLIP
DIRECT
LncBasev2
LOC100129617
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 16
Transcript: NR_045112.1
Biotype: sense
Gene id: NR_045112.1 (gene)
Gene Name: LOC100129617
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:81665375-81665403
exon
HITS-CLIP
DIRECT
LncBasev2
LOC100506281
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 16
Transcript: NR_109777.1
Biotype: antisense
Gene id: NR_109777.1 (gene)
Gene Name: LOC100506281
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:75226547-75226575
exon
HITS-CLIP
DIRECT
LncBasev2
LOC646762
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 7
Transcript: NR_024278.1
Biotype: lincRNA
Gene id: NR_024278.1 (gene)
Gene Name: LOC646762
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:29648626-29648654
exon
HITS-CLIP
DIRECT
LncBasev2
LOC729732
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 8
Transcript: NR_047662.2
Biotype: lincRNA
Gene id: NR_047662.2 (gene)
Gene Name: LOC729732
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
8:12659384-12659412
exon
HITS-CLIP
DIRECT
LncBasev2
LOC90784
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 2
Transcript: NR_026984.1
Biotype: sense
Gene id: NR_026984.1 (gene)
Gene Name: LOC90784
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:86020925-86020953
exon
HITS-CLIP
DIRECT
LncBasev2
LY86-AS1
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 6
Transcript: ENST00000429345
Biotype: antisense
Gene id: ENSG00000216863
Gene Name: LY86-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:6346846-6346874
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: