Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-29b-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
MAGI2-AS3
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000452320
Biotype: retained_intron
Gene id: ENSG00000234456
Gene Name: MAGI2-AS3
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:79464753-79464781
exon
HITS-CLIP
DIRECT
LncBasev2
MALAT1
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000534336
Biotype: lincRNA
Gene id: ENSG00000251562
Gene Name: MALAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
11:65500376-65500404
exon
HITS-CLIP
DIRECT
LncBasev2
11:65500376-65500404
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505431-65505459
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
MDAMB231
IP
Tested Cell Line: MDAMB231
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65500376-65500404
exon
HITS-CLIP
DIRECT
LncBasev2
MBNL1-AS1
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 3
Transcript: ENST00000608395
Biotype: antisense
Gene id: ENSG00000229619
Gene Name: MBNL1-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
HeLa Cervix Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:152268050-152268078
exon
HITS-CLIP
DIRECT
LncBasev2
MGC27345
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 7
Transcript: NR_046216.1
Biotype: sense
Gene id: NR_046216.1 (gene)
Gene Name: MGC27345
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: EF3DAGO2
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:128299533-128299561
exon
PAR-CLIP
DIRECT
LncBasev2
MIAT
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000613780
Biotype: lincRNA
Gene id: ENSG00000225783
Gene Name: MIAT
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
A549 Lung Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:26674881-26674909
exon
HITS-CLIP
DIRECT
LncBasev2
22:26674509-26674537
exon
HITS-CLIP
DIRECT
LncBasev2
MIR29B1
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000432045
Biotype: lincRNA
Gene id: ENSG00000226380
Gene Name: MIR29B1
UCSC graphic:
Expression:
  Cell Line Tissue Category
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:130882724-130882752
exon
HITS-CLIP
DIRECT
LncBasev2
MIR3916
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000421406
Biotype: transcribed_unprocessed_pseudogene
Gene id: ENSG00000227671
Gene Name: MIR3916
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:247190180-247190208
exon
HITS-CLIP
DIRECT
LncBasev2
MIR4458HG
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000606459
Biotype: lincRNA
Gene id: ENSG00000247516
Gene Name: MIR4458HG
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:8460499-8460527
exon
HITS-CLIP
DIRECT
LncBasev2
MIR4697HG
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 11
Transcript: NR_024344.1
Biotype: lincRNA
Gene id: NR_024344.1 (gene)
Gene Name: MIR4697HG
UCSC graphic: -
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:133899135-133899163
exon
HITS-CLIP
DIRECT
LncBasev2
11:133898077-133898105
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:133898077-133898105
exon
HITS-CLIP
DIRECT
LncBasev2
MIR663AHG
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 20
Transcript: ENST00000608084
Biotype: lincRNA
Gene id: ENSG00000227195
Gene Name: MIR663AHG
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
- Lung Normal/Primary
- Testes Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
20:26209275-26209303
exon
HITS-CLIP
DIRECT
LncBasev2
20:26209275-26209303
exon
HITS-CLIP
DIRECT
LncBasev2
20:26209275-26209303
exon
HITS-CLIP
DIRECT
LncBasev2
MIRLET7BHG
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000360737
Biotype: lincRNA
Gene id: ENSG00000197182
Gene Name: MIRLET7BHG
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:46112515-46112543
exon
HITS-CLIP
DIRECT
LncBasev2
MLLT10P1
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 20
Transcript: ENST00000418346
Biotype: processed_pseudogene
Gene id: ENSG00000238151
Gene Name: MLLT10P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:30403116-30403144
exon
HITS-CLIP
DIRECT
LncBasev2
MYL6P1
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 21
Transcript: ENST00000449877
Biotype: processed_pseudogene
Gene id: ENSG00000226543
Gene Name: MYL6P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
21:43856151-43856179
exon
HITS-CLIP
DIRECT
LncBasev2
MYL6P4
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000477911
Biotype: processed_pseudogene
Gene id: ENSG00000240677
Gene Name: MYL6P4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
7:141811971-141811999
exon
HITS-CLIP
DIRECT
LncBasev2
NAMPTL
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 10
Transcript: ENST00000440465
Biotype: processed_pseudogene
Gene id: ENSG00000229644
Gene Name: NAMPTL
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:36522579-36522607
exon
HITS-CLIP
DIRECT
LncBasev2
NCF1B
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000423083
Biotype: processed_transcript
Gene id: ENSG00000182487
Gene Name: NCF1B
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
7:73229702-73229730
exon
HITS-CLIP
DIRECT
LncBasev2
NDUFA9P1
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000436210
Biotype: processed_pseudogene
Gene id: ENSG00000237406
Gene Name: NDUFA9P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:35897728-35897756
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
11:65439133-65439161
exon
HITS-CLIP
DIRECT
LncBasev2
11:65444880-65444908
exon
HITS-CLIP
DIRECT
LncBasev2
11:65444880-65444908
exon
HITS-CLIP
DIRECT
LncBasev2
11:65429844-65429872
exon
HITS-CLIP
DIRECT
LncBasev2
11:65427267-65427295
exon
HITS-CLIP
DIRECT
LncBasev2
11:65429844-65429872
exon
HITS-CLIP
DIRECT
LncBasev2
11:65444880-65444908
exon
HITS-CLIP
DIRECT
LncBasev2
11:65427267-65427295
exon
HITS-CLIP
DIRECT
LncBasev2
11:65429844-65429872
exon
HITS-CLIP
DIRECT
LncBasev2
11:65427267-65427295
exon
HITS-CLIP
DIRECT
LncBasev2
11:65444617-65444645
exon
HITS-CLIP
DIRECT
LncBasev2
11:65427836-65427864
exon
HITS-CLIP
DIRECT
LncBasev2
11:65443743-65443771
exon
HITS-CLIP
DIRECT
LncBasev2
11:65429844-65429872
exon
HITS-CLIP
DIRECT
LncBasev2
11:65444617-65444645
exon
HITS-CLIP
DIRECT
LncBasev2
11:65427267-65427295
exon
HITS-CLIP
DIRECT
LncBasev2
11:65427836-65427864
exon
HITS-CLIP
DIRECT
LncBasev2
11:65427836-65427864
exon
HITS-CLIP
DIRECT
LncBasev2
11:65444617-65444645
exon
HITS-CLIP
DIRECT
LncBasev2
11:65443743-65443771
exon
HITS-CLIP
DIRECT
LncBasev2
11:65429844-65429872
exon
HITS-CLIP
DIRECT
LncBasev2
11:65427267-65427295
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65427836-65427864
exon
HITS-CLIP
DIRECT
LncBasev2
11:65429844-65429872
exon
HITS-CLIP
DIRECT
LncBasev2
11:65438817-65438845
exon
HITS-CLIP
DIRECT
LncBasev2
11:65431300-65431328
exon
HITS-CLIP
DIRECT
LncBasev2
11:65439133-65439161
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65438817-65438845
exon
HITS-CLIP
DIRECT
LncBasev2
11:65431300-65431328
exon
HITS-CLIP
DIRECT
LncBasev2
11:65427836-65427864
exon
HITS-CLIP
DIRECT
LncBasev2
11:65443743-65443771
exon
HITS-CLIP
DIRECT
LncBasev2
11:65432100-65432128
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65443743-65443771
exon
HITS-CLIP
DIRECT
LncBasev2
11:65444617-65444645
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
MDAMB231
IP
Tested Cell Line: MDAMB231
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65432100-65432128
exon
HITS-CLIP
DIRECT
LncBasev2
11:65438817-65438845
exon
HITS-CLIP
DIRECT
LncBasev2
11:65439133-65439161
exon
HITS-CLIP
DIRECT
LncBasev2
11:65429844-65429872
exon
HITS-CLIP
DIRECT
LncBasev2
11:65427267-65427295
exon
HITS-CLIP
DIRECT
LncBasev2
11:65443743-65443771
exon
HITS-CLIP
DIRECT
LncBasev2
11:65444617-65444645
exon
HITS-CLIP
DIRECT
LncBasev2
11:65431300-65431328
exon
HITS-CLIP
DIRECT
LncBasev2
11:65444880-65444908
exon
HITS-CLIP
DIRECT
LncBasev2
11:65432100-65432128
exon
HITS-CLIP
DIRECT
LncBasev2
11:65427836-65427864
exon
HITS-CLIP
DIRECT
LncBasev2
OIP5-AS1
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000500949
Biotype: antisense
Gene id: ENSG00000247556
Gene Name: OIP5-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:41303635-41303663
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:41299992-41300020
exon
HITS-CLIP
DIRECT
LncBasev2
15:41299006-41299034
exon
HITS-CLIP
DIRECT
LncBasev2
15:41303635-41303663
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:41303635-41303663
exon
HITS-CLIP
DIRECT
LncBasev2
OIP5-AS1
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 15
Transcript: NR_026757.1
Biotype: lincRNA
Gene id: NR_026757.1 (gene)
Gene Name: OIP5-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:41299006-41299034
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: