Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-29b-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
PABPC1P4
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000539977
Biotype: processed_pseudogene
Gene id: ENSG00000255642
Gene Name: PABPC1P4
UCSC graphic:
Expression:
  Cell Line Tissue Category
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:63823243-63823271
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:63823243-63823271
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:63823243-63823271
exon
HITS-CLIP
DIRECT
LncBasev2
12:63823342-63823370
exon
HITS-CLIP
DIRECT
LncBasev2
PDIA3P1
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000471856
Biotype: processed_pseudogene
Gene id: ENSG00000180867
Gene Name: PDIA3P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:147178428-147178456
exon
HITS-CLIP
DIRECT
LncBasev2
PDXDC2P
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 16
Transcript: ENST00000525173
Biotype: processed_transcript
Gene id: ENSG00000255185
Gene Name: PDXDC2P
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:70063342-70063370
exon
HITS-CLIP
DIRECT
LncBasev2
PKMP1
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000455804
Biotype: processed_pseudogene
Gene id: ENSG00000236480
Gene Name: PKMP1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:114536537-114536565
exon
HITS-CLIP
DIRECT
LncBasev2
PVRIG2P
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000435460
Biotype: transcribed_unprocessed_pseudogene
Gene id: ENSG00000235333
Gene Name: PVRIG2P
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:100352667-100352695
exon
HITS-CLIP
DIRECT
LncBasev2
7:100352667-100352695
exon
HITS-CLIP
DIRECT
LncBasev2
PWAR6
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 15
Transcript: ENST00000552334
Biotype: lincRNA
Gene id: ENSG00000257151
Gene Name: PWAR6
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
HUVEC Blood Vessel Normal/Primary
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:25032323-25032351
exon
HITS-CLIP
DIRECT
LncBasev2
RAC1P2
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 4
Transcript: ENST00000511164
Biotype: processed_pseudogene
Gene id: ENSG00000249936
Gene Name: RAC1P2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:46723955-46723983
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:46723955-46723983
exon
HITS-CLIP
DIRECT
LncBasev2
RALGAPA1P
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000443361
Biotype: processed_pseudogene
Gene id: ENSG00000229419
Gene Name: RALGAPA1P
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:105526104-105526132
exon
HITS-CLIP
DIRECT
LncBasev2
RANBP20P
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 14
Transcript: ENST00000557256
Biotype: processed_pseudogene
Gene id: ENSG00000259144
Gene Name: RANBP20P
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:20721777-20721805
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-114H7.1
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000498453
Biotype: processed_pseudogene
Gene id: ENSG00000244192
Gene Name: RP11-114H7.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HEK293
Category: Embryonic/Fetal
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:130990265-130990293
exon
PAR-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:130990265-130990293
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-118H4.1
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000411586
Biotype: processed_pseudogene
Gene id: ENSG00000229965
Gene Name: RP11-118H4.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:226439272-226439300
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-1246C19.1
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000609755
Biotype: lincRNA
Gene id: ENSG00000273230
Gene Name: RP11-1246C19.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
7:1465951-1465979
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-145M9.4
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 3
Transcript: ENST00000595265
Biotype: lincRNA
Gene id: ENSG00000269728
Gene Name: RP11-145M9.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
3:179396475-179396503
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:179396475-179396503
exon
HITS-CLIP
DIRECT
LncBasev2
3:179396587-179396615
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-213G2.5
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000442109
Biotype: processed_pseudogene
Gene id: ENSG00000231741
Gene Name: RP11-213G2.5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
9:85935440-85935468
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-216L13.19
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 9
Transcript: ENST00000415992
Biotype: retained_intron
Gene id: ENSG00000273066
Gene Name: RP11-216L13.19
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:136808100-136808128
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-225H22.7
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 10
Transcript: ENST00000608063
Biotype: antisense
Gene id: ENSG00000273485
Gene Name: RP11-225H22.7
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
10:103450438-103450466
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-227G15.3
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000581915
Biotype: processed_transcript
Gene id: ENSG00000265794
Gene Name: RP11-227G15.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:32350298-32350326
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-231D20.2
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000518213
Biotype: antisense
Gene id: ENSG00000253408
Gene Name: RP11-231D20.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:42270892-42270920
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-261N11.8
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 20
Transcript: ENST00000370257
Biotype: antisense
Gene id: ENSG00000203900
Gene Name: RP11-261N11.8
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
20:63368638-63368666
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-282O18.3
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000541002
Biotype: antisense
Gene id: ENSG00000235423
Gene Name: RP11-282O18.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:123261387-123261415
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:123261387-123261415
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: