Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-29b-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
RP11-313J2.1
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 10
Transcript: ENST00000609841
Biotype: processed_transcript
Gene id: ENSG00000215146
Gene Name: RP11-313J2.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:42333857-42333885
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-314B1.2
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000609089
Biotype: lincRNA
Gene id: ENSG00000273301
Gene Name: RP11-314B1.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:225698997-225699025
exon
HITS-CLIP
DIRECT
LncBasev2
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
2:225698997-225699025
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-325P15.2
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000438469
Biotype: processed_pseudogene
Gene id: ENSG00000230832
Gene Name: RP11-325P15.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
1:147082430-147082458
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-331F4.4
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 16
Transcript: ENST00000489723
Biotype: processed_transcript
Gene id: ENSG00000240338
Gene Name: RP11-331F4.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:75226547-75226575
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-334L9.1
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000442006
Biotype: processed_pseudogene
Gene id: ENSG00000215895
Gene Name: RP11-334L9.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:38710151-38710179
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:38710151-38710179
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-343H5.4
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000451736
Biotype: processed_pseudogene
Gene id: ENSG00000224114
Gene Name: RP11-343H5.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
1:206696048-206696076
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-347H15.2
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 11
Transcript: ENST00000525487
Biotype: processed_pseudogene
Gene id: ENSG00000255500
Gene Name: RP11-347H15.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:50268465-50268493
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-374A22.1
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 6
Transcript: ENST00000441521
Biotype: sense_intronic
Gene id: ENSG00000237321
Gene Name: RP11-374A22.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:123823379-123823407
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-379H18.1
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000605778
Biotype: antisense
Gene id: ENSG00000271122
Gene Name: RP11-379H18.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:35695479-35695507
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-380G5.3
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 10
Transcript: ENST00000395256
Biotype: processed_pseudogene
Gene id: ENSG00000213613
Gene Name: RP11-380G5.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:87945871-87945899
exon
PAR-CLIP
DIRECT
LncBasev2
RP11-389G6.3
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 3
Transcript: ENST00000562191
Biotype: sense_overlapping
Gene id: ENSG00000261292
Gene Name: RP11-389G6.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:97760296-97760324
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-392E22.12
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 9
Transcript: ENST00000562942
Biotype: processed_transcript
Gene id: ENSG00000273036
Gene Name: RP11-392E22.12
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:38542433-38542461
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-405A12.1
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000414406
Biotype: processed_pseudogene
Gene id: ENSG00000256849
Gene Name: RP11-405A12.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:19941799-19941827
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
12:19941799-19941827
exon
HITS-CLIP
DIRECT
LncBasev2
12:19941799-19941827
exon
HITS-CLIP
DIRECT
LncBasev2
RP1-142O9.2
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000402892
Biotype: processed_pseudogene
Gene id: ENSG00000217631
Gene Name: RP1-142O9.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:49273764-49273792
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-46C24.7
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000570267
Biotype: antisense
Gene id: ENSG00000259877
Gene Name: RP11-46C24.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:89216818-89216846
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-475C16.1
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000492974
Biotype: processed_pseudogene
Gene id: ENSG00000218426
Gene Name: RP11-475C16.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
6:153282460-153282488
exon
HITS-CLIP
DIRECT
LncBasev2
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:153282460-153282488
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
6:153282460-153282488
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:153282460-153282488
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:153282460-153282488
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-482H16.1
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000607540
Biotype: processed_transcript
Gene id: ENSG00000271894
Gene Name: RP11-482H16.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:56385112-56385140
exon
HITS-CLIP
DIRECT
LncBasev2
2:56384919-56384947
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-507E23.1
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 14
Transcript: ENST00000489251
Biotype: processed_pseudogene
Gene id: ENSG00000242951
Gene Name: RP11-507E23.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:75595797-75595853
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-51O6.1
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 16
Transcript: ENST00000591758
Biotype: processed_transcript
Gene id: ENSG00000224631
Gene Name: RP11-51O6.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:61055684-61055712
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:61055531-61055559
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-571M6.17
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 12
Transcript: ENST00000602802
Biotype: lincRNA
Gene id: ENSG00000270039
Gene Name: RP11-571M6.17
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:57804381-57804409
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: