Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-29b-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
RP11-582E3.6
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 12
Transcript: ENST00000620519
Biotype: lincRNA
Gene id: ENSG00000275764
Gene Name: RP11-582E3.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:27038715-27038743
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:27038715-27038743
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-61A14.3
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000563086
Biotype: lincRNA
Gene id: ENSG00000261088
Gene Name: RP11-61A14.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:66889217-66889245
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-641A6.9
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000549824
Biotype: processed_pseudogene
Gene id: ENSG00000257675
Gene Name: RP11-641A6.9
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:52749489-52749517
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-680G24.4
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 16
Transcript: ENST00000567634
Biotype: processed_pseudogene
Gene id: ENSG00000261819
Gene Name: RP11-680G24.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:14988796-14988824
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-71H17.7
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 3
Transcript: ENST00000568966
Biotype: sense_overlapping
Gene id: ENSG00000260391
Gene Name: RP11-71H17.7
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:124725271-124725299
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-731J8.2
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 4
Transcript: ENST00000562284
Biotype: sense_overlapping
Gene id: ENSG00000260918
Gene Name: RP11-731J8.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:47433144-47433172
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-739G5.1
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 15
Transcript: ENST00000554318
Biotype: lincRNA
Gene id: ENSG00000258631
Gene Name: RP11-739G5.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:93592720-93592748
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-77H9.2
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000565934
Biotype: antisense
Gene id: ENSG00000260276
Gene Name: RP11-77H9.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:8848991-8849019
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-881M11.4
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000543907
Biotype: antisense
Gene id: ENSG00000256196
Gene Name: RP11-881M11.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:60918775-60918803
exon
HITS-CLIP
DIRECT
LncBasev2
RP1-193H18.2
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000588041
Biotype: lincRNA
Gene id: ENSG00000267194
Gene Name: RP1-193H18.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:69552935-69552963
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-981G7.6
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000606115
Biotype: lincRNA
Gene id: ENSG00000272505
Gene Name: RP11-981G7.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:10489366-10489394
exon
HITS-CLIP
DIRECT
LncBasev2
RP13-516M14.1
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000566986
Biotype: lincRNA
Gene id: ENSG00000260563
Gene Name: RP13-516M14.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
17:82294148-82294176
exon
HITS-CLIP
DIRECT
LncBasev2
RP13-638C3.2
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000570869
Biotype: sense_intronic
Gene id: ENSG00000262652
Gene Name: RP13-638C3.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:82578286-82578314
exon
HITS-CLIP
DIRECT
LncBasev2
RP1-89D4.1
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 11
Transcript: ENST00000473603
Biotype: processed_pseudogene
Gene id: ENSG00000241255
Gene Name: RP1-89D4.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:33237389-33237417
exon
HITS-CLIP
DIRECT
LncBasev2
11:33237389-33237417
exon
HITS-CLIP
DIRECT
LncBasev2
RP4-545K15.5
hsa-miR-29b-3p
IP

Gene Details
Chromosome: X
Transcript: ENST00000564612
Biotype: sense_overlapping
Gene id: ENSG00000261101
Gene Name: RP4-545K15.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:101628239-101628267
exon
HITS-CLIP
DIRECT
LncBasev2
RP4-604A21.1
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000425821
Biotype: processed_pseudogene
Gene id: ENSG00000225616
Gene Name: RP4-604A21.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:28982575-28982603
exon
HITS-CLIP
DIRECT
LncBasev2
RP4-630A11.3
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000429871
Biotype: sense_intronic
Gene id: ENSG00000237852
Gene Name: RP4-630A11.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:65494018-65494046
exon
HITS-CLIP
DIRECT
LncBasev2
RP4-714D9.5
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000564623
Biotype: sense_overlapping
Gene id: ENSG00000261254
Gene Name: RP4-714D9.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:100030790-100030818
exon
HITS-CLIP
DIRECT
LncBasev2
RP4-758J24.5
hsa-miR-29b-3p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000606641
Biotype: lincRNA
Gene id: ENSG00000272091
Gene Name: RP4-758J24.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:54026754-54026782
exon
HITS-CLIP
DIRECT
LncBasev2
RP4-814D15.2
hsa-miR-29b-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000429552
Biotype: processed_pseudogene
Gene id: ENSG00000225224
Gene Name: RP4-814D15.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:157192569-157192597
exon
HITS-CLIP
DIRECT
LncBasev2
7:157192719-157192747
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: