Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-30b-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
LINC01311
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000565162
Biotype: antisense
Gene id: ENSG00000260924
Gene Name: LINC01311
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:19172335-19172363
exon
HITS-CLIP
DIRECT
LncBasev2
LOC100652736
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 22
Transcript: NR_103767.1
Biotype: lincRNA
Gene id: NR_103767.1 (gene)
Gene Name: LOC100652736
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:19172335-19172363
exon
HITS-CLIP
DIRECT
LncBasev2
LOC648987
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 5
Transcript: NR_034085.1
Biotype: lincRNA
Gene id: NR_034085.1 (gene)
Gene Name: LOC648987
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:43016713-43016741
exon
PAR-CLIP
DIRECT
LncBasev2
LRRC75A-AS1
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000497774
Biotype: retained_intron
Gene id: ENSG00000175061
Gene Name: LRRC75A-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:16441659-16441687
exon
HITS-CLIP
DIRECT
LncBasev2
17:16441659-16441687
exon
HITS-CLIP
DIRECT
LncBasev2
MALAT1
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000534336
Biotype: lincRNA
Gene id: ENSG00000251562
Gene Name: MALAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65501990-65502018
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501676-65501704
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
11:65501676-65501704
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501676-65501704
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501990-65502018
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501676-65501704
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501990-65502018
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501676-65501704
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501676-65501704
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501990-65502018
exon
HITS-CLIP
DIRECT
LncBasev2
MIR10A
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000548801
Biotype: sense_intronic
Gene id: ENSG00000257178
Gene Name: MIR10A
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
17:48580539-48580567
exon
HITS-CLIP
DIRECT
LncBasev2
17:48581155-48581183
exon
HITS-CLIP
DIRECT
LncBasev2
17:48580701-48580729
exon
HITS-CLIP
DIRECT
LncBasev2
MIR4534
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623111
Biotype: sense_overlapping
Gene id: ENSG00000279010
Gene Name: MIR4534
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
22:38002439-38002467
exon
HITS-CLIP
DIRECT
LncBasev2
22:37997498-37997526
exon
HITS-CLIP
DIRECT
LncBasev2
MIR4697HG
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 11
Transcript: NR_024344.1
Biotype: lincRNA
Gene id: NR_024344.1 (gene)
Gene Name: MIR4697HG
UCSC graphic: -
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
11:133898626-133898654
exon
HITS-CLIP
DIRECT
LncBasev2
MIR663AHG
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 20
Transcript: ENST00000598150
Biotype: lincRNA
Gene id: ENSG00000227195
Gene Name: MIR663AHG
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
- Lung Normal/Primary
- Testes Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
20:26209322-26209350
exon
HITS-CLIP
DIRECT
LncBasev2
20:26209322-26209350
exon
HITS-CLIP
DIRECT
LncBasev2
20:26209322-26209350
exon
HITS-CLIP
DIRECT
LncBasev2
20:26209322-26209350
exon
HITS-CLIP
DIRECT
LncBasev2
20:26209322-26209350
exon
HITS-CLIP
DIRECT
LncBasev2
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:26209322-26209350
exon
HITS-CLIP
DIRECT
LncBasev2
20:26209322-26209350
exon
HITS-CLIP
DIRECT
LncBasev2
MTND5P11
hsa-miR-30b-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000511037
Biotype: processed_pseudogene
Gene id: ENSG00000248923
Gene Name: MTND5P11
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
5:134925206-134925234
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
11:65424457-65424485
exon
HITS-CLIP
DIRECT
LncBasev2
11:65445223-65445251
exon
HITS-CLIP
DIRECT
LncBasev2
11:65444563-65444591
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424457-65424485
exon
HITS-CLIP
DIRECT
LncBasev2
11:65445223-65445251
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424457-65424485
exon
HITS-CLIP
DIRECT
LncBasev2
11:65444797-65444825
exon
HITS-CLIP
DIRECT
LncBasev2
11:65444563-65444591
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424457-65424485
exon
HITS-CLIP
DIRECT
LncBasev2
11:65444797-65444825
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65424457-65424485
exon
HITS-CLIP
DIRECT
LncBasev2
11:65444797-65444825
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-30b-3p
-
IP

Gene Details
Chromosome: 11
Transcript: NR_028272.1
Biotype: lincRNA
Gene id: NR_028272.1 (gene)
Gene Name: NEAT1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65424457-65424485
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
11:65424457-65424485
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424457-65424485
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424457-65424485
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424457-65424485
exon
HITS-CLIP
DIRECT
LncBasev2
OIP5-AS1
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000500949
Biotype: antisense
Gene id: ENSG00000247556
Gene Name: OIP5-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
15:41306097-41306125
exon
HITS-CLIP
DIRECT
LncBasev2
OR2S1P
hsa-miR-30b-3p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000447226
Biotype: unprocessed_pseudogene
Gene id: ENSG00000228307
Gene Name: OR2S1P
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
9:36013779-36013807
exon
HITS-CLIP
DIRECT
LncBasev2
RAB4B-EGLN2
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 19
Transcript: NR_037791.1
Biotype: sense
Gene id: NR_037791.1 (gene)
Gene Name: RAB4B-EGLN2
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
19:40808161-40808189
exon
HITS-CLIP
DIRECT
LncBasev2
RNASEK-C17orf49
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 17
Transcript: NR_037717.1
Biotype: sense
Gene id: NR_037717.1 (gene)
Gene Name: RNASEK-C17orf49
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:7014399-7014427
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-1055B8.4
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000571724
Biotype: lincRNA
Gene id: ENSG00000262877
Gene Name: RP11-1055B8.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:81390146-81390174
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-156P1.3
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000574741
Biotype: lincRNA
Gene id: ENSG00000262879
Gene Name: RP11-156P1.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:47100028-47100056
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-15H20.6
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000397094
Biotype: lincRNA
Gene id: ENSG00000213971
Gene Name: RP11-15H20.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
19:23260468-23260496
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-218E20.3
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000553648
Biotype: lincRNA
Gene id: ENSG00000258711
Gene Name: RP11-218E20.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
- Prostate Normal/Primary
- Thyroid Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
14:50959663-50959691
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: