Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-30b-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
RP11-227G15.12
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000625127
Biotype: antisense
Gene id: ENSG00000279762
Gene Name: RP11-227G15.12
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
17:32444794-32444822
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-241M13.2
hsa-miR-30b-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000618630
Biotype: unprocessed_pseudogene
Gene id: ENSG00000276362
Gene Name: RP11-241M13.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
2:84850931-84850959
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-290F20.1
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 20
Transcript: NR_034124.1
Biotype: lincRNA
Gene id: NR_034124.1 (gene)
Gene Name: RP11-290F20.1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:50312373-50312401
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-363N22.3
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 10
Transcript: ENST00000615314
Biotype: retained_intron
Gene id: ENSG00000205740
Gene Name: RP11-363N22.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
10:987060-987088
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-3D4.2
hsa-miR-30b-3p
-
IP

Gene Details
Chromosome: 15
Transcript: ENST00000560268
Biotype: antisense
Gene id: ENSG00000259287
Gene Name: RP11-3D4.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
15:33864744-33864772
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-3M1.3
hsa-miR-30b-3p
-
IP

Gene Details
Chromosome: 16
Transcript: ENST00000563813
Biotype: processed_pseudogene
Gene id: ENSG00000261017
Gene Name: RP11-3M1.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
16:48059648-48059676
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-436H11.1
hsa-miR-30b-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000464124
Biotype: processed_pseudogene
Gene id: ENSG00000242814
Gene Name: RP11-436H11.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:124809005-124809033
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-445F12.1
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000621428
Biotype: antisense
Gene id: ENSG00000277268
Gene Name: RP11-445F12.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Kidney Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
17:36933231-36933259
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-461H3.2
hsa-miR-30b-3p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000442343
Biotype: processed_pseudogene
Gene id: ENSG00000231368
Gene Name: RP11-461H3.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBAC
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:148648208-148648236
exon
PAR-CLIP
DIRECT
LncBasev2
RP11-475C16.1
hsa-miR-30b-3p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000492974
Biotype: processed_pseudogene
Gene id: ENSG00000218426
Gene Name: RP11-475C16.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:153282435-153282463
exon
HITS-CLIP
DIRECT
LncBasev2
6:153282583-153282611
exon
HITS-CLIP
DIRECT
LncBasev2
6:153282583-153282611
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-522B15.3
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000558499
Biotype: lincRNA
Gene id: ENSG00000259275
Gene Name: RP11-522B15.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
15:96392440-96392468
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-550C4.4
hsa-miR-30b-3p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000403255
Biotype: processed_pseudogene
Gene id: ENSG00000216616
Gene Name: RP11-550C4.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
6:47752890-47752918
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-685M7.3
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000499765
Biotype: antisense
Gene id: ENSG00000246308
Gene Name: RP11-685M7.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
11:10820811-10820839
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-692N5.2
hsa-miR-30b-3p
-
IP

Gene Details
Chromosome: 18
Transcript: ENST00000578806
Biotype: processed_pseudogene
Gene id: ENSG00000266891
Gene Name: RP11-692N5.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
18:9734911-9734939
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-709D24.8
hsa-miR-30b-3p
-
IP

Gene Details
Chromosome: 16
Transcript: ENST00000612995
Biotype: sense_intronic
Gene id: ENSG00000278434
Gene Name: RP11-709D24.8
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
16:4533226-4533254
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-715J22.2
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000563775
Biotype: antisense
Gene id: ENSG00000259895
Gene Name: RP11-715J22.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
16:2467756-2467784
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-783K16.13
hsa-miR-30b-3p
-
IP

Gene Details
Chromosome: 11
Transcript: ENST00000545800
Biotype: lincRNA
Gene id: ENSG00000257086
Gene Name: RP11-783K16.13
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
11:64249473-64249501
exon
HITS-CLIP
DIRECT
LncBasev2
RP13-991F5.2
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000582249
Biotype: antisense
Gene id: ENSG00000266445
Gene Name: RP13-991F5.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:82476999-82477027
exon
HITS-CLIP
DIRECT
LncBasev2
RP4-773N10.4
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000554749
Biotype: antisense
Gene id: ENSG00000258634
Gene Name: RP4-773N10.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
1:110059648-110059676
exon
HITS-CLIP
DIRECT
LncBasev2
RP5-1021I20.1
hsa-miR-30b-3p
-
IP

Gene Details
Chromosome: 14
Transcript: ENST00000556194
Biotype: antisense
Gene id: ENSG00000259065
Gene Name: RP5-1021I20.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
14:73802900-73802928
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: