Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-30b-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
RP5-821D11.7
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000333487
Biotype: antisense
Gene id: ENSG00000184068
Gene Name: RP5-821D11.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
22:41833374-41833402
exon
HITS-CLIP
DIRECT
LncBasev2
RP5-857K21.7
hsa-miR-30b-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000427426
Biotype: unprocessed_pseudogene
Gene id: ENSG00000229344
Gene Name: RP5-857K21.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
1:632966-632994
exon
HITS-CLIP
DIRECT
LncBasev2
RP5-890E16.2
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000578660
Biotype: retained_intron
Gene id: ENSG00000263412
Gene Name: RP5-890E16.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
17:48047269-48047297
exon
HITS-CLIP
DIRECT
LncBasev2
RP5-984P4.6
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 20
Transcript: ENST00000622757
Biotype: lincRNA
Gene id: ENSG00000278041
Gene Name: RP5-984P4.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
20:21501164-21501192
exon
HITS-CLIP
DIRECT
LncBasev2
RPPH1
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000554988
Biotype: antisense
Gene id: ENSG00000259001
Gene Name: RPPH1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:20343347-20343375
exon
HITS-CLIP
DIRECT
LncBasev2
14:20343266-20343294
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
14:20343266-20343294
exon
HITS-CLIP
DIRECT
LncBasev2
14:20343347-20343375
exon
HITS-CLIP
DIRECT
LncBasev2
14:20343347-20343375
exon
HITS-CLIP
DIRECT
LncBasev2
14:20343266-20343294
exon
HITS-CLIP
DIRECT
LncBasev2
14:20343347-20343375
exon
HITS-CLIP
DIRECT
LncBasev2
RPS7P1
hsa-miR-30b-3p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000571702
Biotype: processed_pseudogene
Gene id: ENSG00000263266
Gene Name: RPS7P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:28468146-28468174
exon
HITS-CLIP
DIRECT
LncBasev2
RPS7P4
hsa-miR-30b-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000444127
Biotype: processed_pseudogene
Gene id: ENSG00000229133
Gene Name: RPS7P4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
1:68242703-68242731
exon
HITS-CLIP
DIRECT
LncBasev2
SCOCP1
hsa-miR-30b-3p
-
IP

Gene Details
Chromosome: 14
Transcript: ENST00000554676
Biotype: processed_pseudogene
Gene id: ENSG00000258896
Gene Name: SCOCP1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
14:60158994-60159022
exon
HITS-CLIP
DIRECT
LncBasev2
SENP3-EIF4A1
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 17
Transcript: NR_037926.1
Biotype: sense
Gene id: NR_037926.1 (gene)
Gene Name: SENP3-EIF4A1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
17:7578674-7578702
exon
HITS-CLIP
DIRECT
LncBasev2
SNHG1
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000538654
Biotype: retained_intron
Gene id: ENSG00000255717
Gene Name: SNHG1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
11:62852988-62853016
exon
HITS-CLIP
DIRECT
LncBasev2
11:62852988-62853016
exon
HITS-CLIP
DIRECT
LncBasev2
11:62852988-62853016
exon
HITS-CLIP
DIRECT
LncBasev2
11:62852988-62853016
exon
HITS-CLIP
DIRECT
LncBasev2
11:62852988-62853016
exon
HITS-CLIP
DIRECT
LncBasev2
11:62852205-62852233
exon
HITS-CLIP
DIRECT
LncBasev2
SNHG15
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000577700
Biotype: lincRNA
Gene id: ENSG00000232956
Gene Name: SNHG15
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
7:44983988-44984016
exon
HITS-CLIP
DIRECT
LncBasev2
SNHG16
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000448136
Biotype: lincRNA
Gene id: ENSG00000163597
Gene Name: SNHG16
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:76565236-76565264
exon
HITS-CLIP
DIRECT
LncBasev2
SNORA67
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000581621
Biotype: processed_transcript
Gene id: ENSG00000264772
Gene Name: SNORA67
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
17:7578674-7578702
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:7580194-7580222
exon
HITS-CLIP
DIRECT
LncBasev2
17:7581769-7581814
exon
HITS-CLIP
DIRECT
LncBasev2
SNORD91B
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000608459
Biotype: sense_intronic
Gene id: ENSG00000275084
Gene Name: SNORD91B
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:2329157-2329185
exon
HITS-CLIP
DIRECT
LncBasev2
17:2329157-2329185
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:2329157-2329185
exon
HITS-CLIP
DIRECT
LncBasev2
SRPK2P
hsa-miR-30b-3p
-
IP

Gene Details
Chromosome: 8
Transcript: ENST00000523408
Biotype: processed_pseudogene
Gene id: ENSG00000253431
Gene Name: SRPK2P
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
8:62863642-62863670
exon
HITS-CLIP
DIRECT
LncBasev2
ST7-OT4
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000597499
Biotype: sense_intronic
Gene id: ENSG00000214188
Gene Name: ST7-OT4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
7:116956935-116956963
exon
HITS-CLIP
DIRECT
LncBasev2
SUZ12P1
hsa-miR-30b-3p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000582557
Biotype: processed_transcript
Gene id: ENSG00000264538
Gene Name: SUZ12P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
17:30769967-30769995
exon
HITS-CLIP
DIRECT
LncBasev2
TLK1P1
hsa-miR-30b-3p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000456760
Biotype: processed_pseudogene
Gene id: ENSG00000226783
Gene Name: TLK1P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
9:122685999-122686027
exon
HITS-CLIP
DIRECT
LncBasev2
TMEM198B
hsa-miR-30b-3p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000478241
Biotype: processed_transcript
Gene id: ENSG00000182796
Gene Name: TMEM198B
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
12:55836118-55836146
exon
HITS-CLIP
DIRECT
LncBasev2
TP73-AS1
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000452079
Biotype: antisense
Gene id: ENSG00000227372
Gene Name: TP73-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
1:3739126-3739154
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: