Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-30b-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
TP73-AS1
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 1
Transcript: NR_033710.1
Biotype: antisense
Gene id: NR_033710.1 (gene)
Gene Name: TP73-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
1:3739126-3739154
exon
HITS-CLIP
DIRECT
LncBasev2
TUG1
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000519077
Biotype: antisense
Gene id: ENSG00000253352
Gene Name: TUG1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:30977376-30977404
exon
HITS-CLIP
DIRECT
LncBasev2
22:30977376-30977404
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:30977376-30977404
exon
HITS-CLIP
DIRECT
LncBasev2
U73166.2
hsa-miR-30b-3p
IP

Gene Details
Chromosome: 3
Transcript: ENST00000439898
Biotype: lincRNA
Gene id: ENSG00000230454
Gene Name: U73166.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
3:50261074-50261102
exon
HITS-CLIP
DIRECT
LncBasev2
3:50261074-50261102
exon
HITS-CLIP
DIRECT
LncBasev2
XIST
hsa-miR-30b-3p
IP

Gene Details
Chromosome: X
Transcript: ENST00000429829
Biotype: lincRNA
Gene id: ENSG00000229807
Gene Name: XIST
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
X:73841599-73841627
exon
HITS-CLIP
DIRECT
LncBasev2
X:73850956-73850984
exon
HITS-CLIP
DIRECT
LncBasev2
X:73849830-73849858
exon
HITS-CLIP
DIRECT
LncBasev2
X:73841599-73841627
exon
HITS-CLIP
DIRECT
LncBasev2
X:73849891-73849919
exon
HITS-CLIP
DIRECT
LncBasev2
X:73831107-73831135
exon
HITS-CLIP
DIRECT
LncBasev2
X:73845809-73845837
exon
HITS-CLIP
DIRECT
LncBasev2
X:73846736-73846764
exon
HITS-CLIP
DIRECT
LncBasev2
X:73849925-73849953
exon
HITS-CLIP
DIRECT
LncBasev2
X:73849925-73849953
exon
HITS-CLIP
DIRECT
LncBasev2
X:73849891-73849919
exon
HITS-CLIP
DIRECT
LncBasev2
X:73843001-73843029
exon
HITS-CLIP
DIRECT
LncBasev2
X:73844616-73844644
exon
HITS-CLIP
DIRECT
LncBasev2
X:73843439-73843467
exon
HITS-CLIP
DIRECT
LncBasev2
X:73849830-73849876
exon
HITS-CLIP
DIRECT
LncBasev2
X:73845809-73845837
exon
HITS-CLIP
DIRECT
LncBasev2
X:73826140-73826168
exon
HITS-CLIP
DIRECT
LncBasev2
X:73841599-73841627
exon
HITS-CLIP
DIRECT
LncBasev2
X:73845809-73845837
exon
HITS-CLIP
DIRECT
LncBasev2
X:73843439-73843467
exon
HITS-CLIP
DIRECT
LncBasev2
X:73843001-73843029
exon
HITS-CLIP
DIRECT
LncBasev2
X:73845809-73845837
exon
HITS-CLIP
DIRECT
LncBasev2
X:73843439-73843467
exon
HITS-CLIP
DIRECT
LncBasev2
X:73849925-73849953
exon
HITS-CLIP
DIRECT
LncBasev2
X:73849830-73849858
exon
HITS-CLIP
DIRECT
LncBasev2
X:73850956-73850984
exon
HITS-CLIP
DIRECT
LncBasev2
X:73826140-73826168
exon
HITS-CLIP
DIRECT
LncBasev2
X:73831107-73831135
exon
HITS-CLIP
DIRECT
LncBasev2
X:73849848-73849876
exon
HITS-CLIP
DIRECT
LncBasev2
X:73850956-73850984
exon
HITS-CLIP
DIRECT
LncBasev2
X:73826140-73826168
exon
HITS-CLIP
DIRECT
LncBasev2
X:73845809-73845837
exon
HITS-CLIP
DIRECT
LncBasev2
X:73843439-73843467
exon
HITS-CLIP
DIRECT
LncBasev2
X:73849830-73849876
exon
HITS-CLIP
DIRECT
LncBasev2
X:73847116-73847144
exon
HITS-CLIP
DIRECT
LncBasev2
X:73826140-73826168
exon
HITS-CLIP
DIRECT
LncBasev2
X:73843001-73843029
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_000010
hsa-miR-30b-3p
IP

Gene Details
Chromosome: chr1
Transcript: TCONS_00000796
Biotype: transcript isomorph
Gene id: XLOC_000010
Gene Name: XLOC_000010
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Prostate Normal/Primary
- Testes Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
chr1:905113-905141
exon
HITS-CLIP
DIRECT
LncBasev2
chr1:905113-905141
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_001181
hsa-miR-30b-3p
IP

Gene Details
Chromosome: chr1
Transcript: TCONS_00002573
Biotype: transcript isomorph
Gene id: XLOC_001181
Gene Name: XLOC_001181
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Liver Normal/Primary
- Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
chr1:207806742-207806770
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_001417
hsa-miR-30b-3p
IP

Gene Details
Chromosome: chr2
Transcript: TCONS_00004743
Biotype: transcript isomorph
Gene id: XLOC_001417
Gene Name: XLOC_001417
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
chr2:32311057-32311085
exon
PAR-CLIP
DIRECT
LncBasev2
Tested Cell Line: LCLBAC
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
chr2:32311057-32311085
exon
PAR-CLIP
DIRECT
LncBasev2
chr2:32311057-32311085
exon
PAR-CLIP
DIRECT
LncBasev2
chr2:32311057-32311085
exon
PAR-CLIP
DIRECT
LncBasev2
XLOC_004804
hsa-miR-30b-3p
IP

Gene Details
Chromosome: chr5
Transcript: TCONS_00010322
Biotype: transcript isomorph
Gene id: XLOC_004804
Gene Name: XLOC_004804
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
chr5:43016713-43016741
exon
PAR-CLIP
DIRECT
LncBasev2
XLOC_006028
hsa-miR-30b-3p
IP

Gene Details
Chromosome: chr7
Transcript: TCONS_00012984
Biotype: transcript isomorph
Gene id: XLOC_006028
Gene Name: XLOC_006028
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
chr7:27361867-27361895
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_006242
hsa-miR-30b-3p
IP

Gene Details
Chromosome: chr7
Transcript: TCONS_00014209
Biotype: transcript isomorph
Gene id: XLOC_006242
Gene Name: XLOC_006242
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
chr7:128640070-128640098
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_009934
hsa-miR-30b-3p
IP

Gene Details
Chromosome: chr12
Transcript: TCONS_00020617
Biotype: transcript isomorph
Gene id: XLOC_009934
Gene Name: XLOC_009934
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Placenta Normal/Primary
- Testes Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
chr12:125987188-125987216
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_010870
hsa-miR-30b-3p
IP

Gene Details
Chromosome: chr14
Transcript: TCONS_00023015
Biotype: transcript isomorph
Gene id: XLOC_010870
Gene Name: XLOC_010870
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
chr14:73802900-73802928
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_011753
hsa-miR-30b-3p
IP

Gene Details
Chromosome: chr16
Transcript: TCONS_00024436
Biotype: transcript isomorph
Gene id: XLOC_011753
Gene Name: XLOC_011753
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Kidney Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Thyroid Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
chr16:65138640-65138668
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_012255
hsa-miR-30b-3p
IP

Gene Details
Chromosome: chr17
Transcript: TCONS_00025436
Biotype: transcript isomorph
Gene id: XLOC_012255
Gene Name: XLOC_012255
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Breast Normal/Primary
- Lung Normal/Primary
- Ovary Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: EF3DAGO2
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
chr17:55617637-55617665
exon
PAR-CLIP
DIRECT
LncBasev2
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
chr17:55617637-55617665
exon
PAR-CLIP
DIRECT
LncBasev2
XLOC_012503
hsa-miR-30b-3p
IP

Gene Details
Chromosome: chr17
Transcript: TCONS_00025687
Biotype: transcript isomorph
Gene id: XLOC_012503
Gene Name: XLOC_012503
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
A549 Lung Cancer/Malignant
- Lung Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
chr17:48047269-48047297
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_012587
hsa-miR-30b-3p
IP

Gene Details
Chromosome: chr17
Transcript: TCONS_00025781
Biotype: transcript isomorph
Gene id: XLOC_012587
Gene Name: XLOC_012587
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
chr17:81390146-81390174
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_013981
hsa-miR-30b-3p
IP

Gene Details
Chromosome: chr21
Transcript: TCONS_00028752
Biotype: transcript isomorph
Gene id: XLOC_013981
Gene Name: XLOC_013981
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
chr21:45292847-45292875
exon
HITS-CLIP
DIRECT
LncBasev2
chr21:45292847-45292875
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: