Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-34b-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
HSP90B3P
hsa-miR-34b-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000415545
Biotype: processed_pseudogene
Gene id: ENSG00000203914
Gene Name: HSP90B3P
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:91643034-91643062
exon
HITS-CLIP
DIRECT
LncBasev2
HSPA8P8
hsa-miR-34b-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000419827
Biotype: processed_pseudogene
Gene id: ENSG00000229091
Gene Name: HSPA8P8
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:10451507-10451535
exon
HITS-CLIP
DIRECT
LncBasev2
HSPA9P1
hsa-miR-34b-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000432228
Biotype: processed_pseudogene
Gene id: ENSG00000226666
Gene Name: HSPA9P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:221963221-221963249
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00641
hsa-miR-34b-3p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000555379
Biotype: retained_intron
Gene id: ENSG00000258441
Gene Name: LINC00641
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:21200860-21200888
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00657
hsa-miR-34b-3p
IP

Gene Details
Chromosome: 20
Transcript: ENST00000565493
Biotype: lincRNA
Gene id: ENSG00000260032
Gene Name: LINC00657
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:36045712-36045740
exon
HITS-CLIP
DIRECT
LncBasev2
MALAT1
hsa-miR-34b-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000534336
Biotype: lincRNA
Gene id: ENSG00000251562
Gene Name: MALAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65499491-65499519
exon
HITS-CLIP
DIRECT
LncBasev2
11:65499441-65499469
exon
HITS-CLIP
DIRECT
LncBasev2
MEG3
hsa-miR-34b-3p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000522771
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:100848431-100848459
exon
HITS-CLIP
DIRECT
LncBasev2
MTATP6P1
hsa-miR-34b-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000514057
Biotype: unprocessed_pseudogene
Gene id: ENSG00000248527
Gene Name: MTATP6P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:634010-634038
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:634010-634038
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-34b-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65443468-65443496
exon
HITS-CLIP
DIRECT
LncBasev2
11:65440388-65440416
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65440235-65440263
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425652-65425680
exon
HITS-CLIP
DIRECT
LncBasev2
11:65436469-65436497
exon
HITS-CLIP
DIRECT
LncBasev2
11:65435466-65435494
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-34b-3p
IP

Gene Details
Chromosome: 11
Transcript: NR_028272.1
Biotype: lincRNA
Gene id: NR_028272.1 (gene)
Gene Name: NEAT1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65425652-65425680
exon
HITS-CLIP
DIRECT
LncBasev2
NME2P1
hsa-miR-34b-3p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000426182
Biotype: processed_pseudogene
Gene id: ENSG00000123009
Gene Name: NME2P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:120282594-120282622
exon
HITS-CLIP
DIRECT
LncBasev2
OIP5-AS1
hsa-miR-34b-3p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000500949
Biotype: antisense
Gene id: ENSG00000247556
Gene Name: OIP5-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:41305541-41305569
exon
HITS-CLIP
DIRECT
LncBasev2
15:41304267-41304295
exon
HITS-CLIP
DIRECT
LncBasev2
PDIA3P1
hsa-miR-34b-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000471856
Biotype: processed_pseudogene
Gene id: ENSG00000180867
Gene Name: PDIA3P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:147179283-147179311
exon
HITS-CLIP
DIRECT
LncBasev2
RP1-102G20.2
hsa-miR-34b-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000448158
Biotype: processed_pseudogene
Gene id: ENSG00000237249
Gene Name: RP1-102G20.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:174893070-174893098
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-159D12.2
hsa-miR-34b-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000585065
Biotype: lincRNA
Gene id: ENSG00000264112
Gene Name: RP11-159D12.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:57991602-57991630
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-175O19.4
hsa-miR-34b-3p
-
IP

Gene Details
Chromosome: 10
Transcript: ENST00000421806
Biotype: antisense
Gene id: ENSG00000231025
Gene Name: RP11-175O19.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:96995426-96995454
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-212P7.1
hsa-miR-34b-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000393266
Biotype: processed_pseudogene
Gene id: ENSG00000213280
Gene Name: RP11-212P7.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:128570443-128570471
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-342K6.1
hsa-miR-34b-3p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000604845
Biotype: antisense
Gene id: ENSG00000270696
Gene Name: RP11-342K6.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:75661838-75661866
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-39C10.1
hsa-miR-34b-3p
-
IP

Gene Details
Chromosome: 4
Transcript: ENST00000509378
Biotype: processed_pseudogene
Gene id: ENSG00000250746
Gene Name: RP11-39C10.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:164189597-164189625
exon
HITS-CLIP
DIRECT
LncBasev2
RP1-142O9.2
hsa-miR-34b-3p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000402892
Biotype: processed_pseudogene
Gene id: ENSG00000217631
Gene Name: RP1-142O9.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:49273693-49273721
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: