Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-548h-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
RP11-226L15.5
hsa-miR-548h-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000562313
Biotype: sense_overlapping
Gene id: ENSG00000260766
Gene Name: RP11-226L15.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBACD1
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:160025507-160025535
exon
PAR-CLIP
DIRECT
LncBasev2
RP11-262D11.2
hsa-miR-548h-5p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000623354
Biotype: processed_transcript
Gene id: ENSG00000225471
Gene Name: RP11-262D11.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:72160341-72160369
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-283I3.6
hsa-miR-548h-5p
IP

Gene Details
Chromosome: 12
Transcript: ENST00000570140
Biotype: sense_overlapping
Gene id: ENSG00000261799
Gene Name: RP11-283I3.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
12:274423-274451
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-475C16.1
hsa-miR-548h-5p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000492974
Biotype: processed_pseudogene
Gene id: ENSG00000218426
Gene Name: RP11-475C16.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:153282574-153282602
exon
HITS-CLIP
DIRECT
LncBasev2
SCARNA10
hsa-miR-548h-5p
IP

Gene Details
Chromosome: 12
Transcript: ENST00000541782
Biotype: sense_intronic
Gene id: ENSG00000276232
Gene Name: SCARNA10
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
12:6510345-6510373
exon
HITS-CLIP
DIRECT
LncBasev2
SDAD1P2
hsa-miR-548h-5p
-
IP

Gene Details
Chromosome: 20
Transcript: ENST00000441308
Biotype: processed_pseudogene
Gene id: ENSG00000230750
Gene Name: SDAD1P2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
20:10387765-10387793
exon
HITS-CLIP
DIRECT
LncBasev2
SNHG17
hsa-miR-548h-5p
-
IP

Gene Details
Chromosome: 20
Transcript: ENST00000449469
Biotype: retained_intron
Gene id: ENSG00000196756
Gene Name: SNHG17
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
20:38429026-38429054
exon
HITS-CLIP
DIRECT
LncBasev2
SNHG5
hsa-miR-548h-5p
IP

Gene Details
Chromosome: 6
Transcript: ENST00000431043
Biotype: retained_intron
Gene id: ENSG00000203875
Gene Name: SNHG5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
6:85677314-85677342
exon
HITS-CLIP
DIRECT
LncBasev2
6:85677314-85677342
exon
HITS-CLIP
DIRECT
LncBasev2
6:85677314-85677342
exon
HITS-CLIP
DIRECT
LncBasev2
WWC3-AS1
hsa-miR-548h-5p
IP

Gene Details
Chromosome: X
Transcript: ENST00000430057
Biotype: antisense
Gene id: ENSG00000225076
Gene Name: WWC3-AS1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
X:10038369-10038397
exon
HITS-CLIP
DIRECT
LncBasev2
X:10038369-10038397
exon
HITS-CLIP
DIRECT
LncBasev2
X:10038369-10038397
exon
HITS-CLIP
DIRECT
LncBasev2
XIST
hsa-miR-548h-5p
IP

Gene Details
Chromosome: X
Transcript: ENST00000429829
Biotype: lincRNA
Gene id: ENSG00000229807
Gene Name: XIST
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
X:73823921-73823949
exon
HITS-CLIP
DIRECT
LncBasev2
X:73843761-73843789
exon
HITS-CLIP
DIRECT
LncBasev2
X:73846666-73846694
exon
HITS-CLIP
DIRECT
LncBasev2
X:73843802-73843830
exon
HITS-CLIP
DIRECT
LncBasev2
X:73826542-73826570
exon
HITS-CLIP
DIRECT
LncBasev2
X:73824063-73824091
exon
HITS-CLIP
DIRECT
LncBasev2
X:73848230-73848258
exon
HITS-CLIP
DIRECT
LncBasev2
X:73851931-73851959
exon
HITS-CLIP
DIRECT
LncBasev2
X:73824063-73824091
exon
HITS-CLIP
DIRECT
LncBasev2
X:73826542-73826570
exon
HITS-CLIP
DIRECT
LncBasev2
X:73848230-73848258
exon
HITS-CLIP
DIRECT
LncBasev2
X:73846666-73846694
exon
HITS-CLIP
DIRECT
LncBasev2
X:73851931-73851959
exon
HITS-CLIP
DIRECT
LncBasev2
X:73843802-73843830
exon
HITS-CLIP
DIRECT
LncBasev2
X:73851931-73851959
exon
HITS-CLIP
DIRECT
LncBasev2
X:73848230-73848258
exon
HITS-CLIP
DIRECT
LncBasev2
X:73846666-73846694
exon
HITS-CLIP
DIRECT
LncBasev2
X:73826542-73826570
exon
HITS-CLIP
DIRECT
LncBasev2
X:73826542-73826570
exon
HITS-CLIP
DIRECT
LncBasev2
X:73843802-73843830
exon
HITS-CLIP
DIRECT
LncBasev2
X:73845757-73845785
exon
HITS-CLIP
DIRECT
LncBasev2
X:73844341-73844369
exon
HITS-CLIP
DIRECT
LncBasev2
X:73826542-73826570
exon
HITS-CLIP
DIRECT
LncBasev2
X:73824063-73824091
exon
HITS-CLIP
DIRECT
LncBasev2
X:73846666-73846694
exon
HITS-CLIP
DIRECT
LncBasev2
X:73843761-73843789
exon
HITS-CLIP
DIRECT
LncBasev2
X:73844341-73844369
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: