Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-641

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
KCNQ1OT1
hsa-miR-641
IP

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:2676520-2676548
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00657
hsa-miR-641
IP

Gene Details
Chromosome: 20
Transcript: ENST00000565493
Biotype: lincRNA
Gene id: ENSG00000260032
Gene Name: LINC00657
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
20:36048940-36048968
exon
HITS-CLIP
DIRECT
LncBasev2
20:36048776-36048804
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
20:36048776-36048804
exon
HITS-CLIP
DIRECT
LncBasev2
20:36048170-36048198
exon
HITS-CLIP
DIRECT
LncBasev2
20:36048776-36048804
exon
HITS-CLIP
DIRECT
LncBasev2
20:36048776-36048804
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:36048940-36048968
exon
HITS-CLIP
DIRECT
LncBasev2
20:36049347-36049375
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00888
hsa-miR-641
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000482098
Biotype: retained_intron
Gene id: ENSG00000240024
Gene Name: LINC00888
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:183453832-183453860
exon
HITS-CLIP
DIRECT
LncBasev2
LINC01102
hsa-miR-641
IP

Gene Details
Chromosome: 2
Transcript: ENST00000451400
Biotype: lincRNA
Gene id: ENSG00000235597
Gene Name: LINC01102
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
2:104433406-104433434
exon
HITS-CLIP
DIRECT
LncBasev2
LINC01233
hsa-miR-641
IP

Gene Details
Chromosome: 19
Transcript: ENST00000598832
Biotype: lincRNA
Gene id: ENSG00000269364
Gene Name: LINC01233
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary
- Thyroid Normal/Primary

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
19:22533261-22533289
exon
HITS-CLIP
DIRECT
LncBasev2
LOC401324
hsa-miR-641
IP

Gene Details
Chromosome: 7
Transcript: NR_038864.1
Biotype: lincRNA
Gene id: NR_038864.1 (gene)
Gene Name: LOC401324
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
7:35373485-35373513
exon
HITS-CLIP
DIRECT
LncBasev2
LOC646719
hsa-miR-641
IP

Gene Details
Chromosome: 5
Transcript: NR_046262.1
Biotype: lincRNA
Gene id: NR_046262.1 (gene)
Gene Name: LOC646719
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:36873168-36873196
exon
HITS-CLIP
DIRECT
LncBasev2
MALAT1
hsa-miR-641
IP

Gene Details
Chromosome: 11
Transcript: ENST00000534336
Biotype: lincRNA
Gene id: ENSG00000251562
Gene Name: MALAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
11:65505657-65505685
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504323-65504351
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505657-65505685
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501232-65501260
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504323-65504351
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505657-65505685
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501232-65501260
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504323-65504351
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504323-65504351
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505657-65505685
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504323-65504351
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501232-65501260
exon
HITS-CLIP
DIRECT
LncBasev2
MEG3
hsa-miR-641
IP

Gene Details
Chromosome: 14
Transcript: ENST00000522771
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:100829293-100829321
exon
HITS-CLIP
DIRECT
LncBasev2
14:100830936-100830964
exon
HITS-CLIP
DIRECT
LncBasev2
MEG3
hsa-miR-641
IP

Gene Details
Chromosome: 14
Transcript: NR_046467.1
Biotype: lincRNA
Gene id: NR_046467.1 (gene)
Gene Name: MEG3
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:100829293-100829321
exon
HITS-CLIP
DIRECT
LncBasev2
MIA-RAB4B
hsa-miR-641
IP

Gene Details
Chromosome: 19
Transcript: NR_037775.1
Biotype: sense
Gene id: NR_037775.1 (gene)
Gene Name: MIA-RAB4B
UCSC graphic: -
Expression:
  Cell Line Tissue Category
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
19:40796739-40796767
exon
HITS-CLIP
DIRECT
LncBasev2
MORF4L2-AS1
hsa-miR-641
IP

Gene Details
Chromosome: X
Transcript: ENST00000435306
Biotype: antisense
Gene id: ENSG00000231154
Gene Name: MORF4L2-AS1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:103688573-103688601
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-641
IP

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
11:65429173-65429201
exon
HITS-CLIP
DIRECT
LncBasev2
11:65437614-65437642
exon
HITS-CLIP
DIRECT
LncBasev2
11:65426200-65426228
exon
HITS-CLIP
DIRECT
LncBasev2
11:65426200-65426228
exon
HITS-CLIP
DIRECT
LncBasev2
11:65436053-65436081
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425646-65425674
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425646-65425674
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425327-65425355
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425327-65425355
exon
HITS-CLIP
DIRECT
LncBasev2
11:65426200-65426228
exon
HITS-CLIP
DIRECT
LncBasev2
11:65443347-65443375
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425646-65425674
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425737-65425765
exon
HITS-CLIP
DIRECT
LncBasev2
11:65437600-65437642
exon
HITS-CLIP
DIRECT
LncBasev2
11:65432115-65432143
exon
HITS-CLIP
DIRECT
LncBasev2
11:65443420-65443448
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425327-65425355
exon
HITS-CLIP
DIRECT
LncBasev2
11:65426200-65426228
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425737-65425765
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425646-65425674
exon
HITS-CLIP
DIRECT
LncBasev2
11:65437600-65437628
exon
HITS-CLIP
DIRECT
LncBasev2
11:65429173-65429201
exon
HITS-CLIP
DIRECT
LncBasev2
11:65433137-65433165
exon
HITS-CLIP
DIRECT
LncBasev2
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
11:65425737-65425765
exon
HITS-CLIP
DIRECT
LncBasev2
11:65437600-65437642
exon
HITS-CLIP
DIRECT
LncBasev2
11:65440126-65440165
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65429173-65429201
exon
HITS-CLIP
DIRECT
LncBasev2
11:65443347-65443375
exon
HITS-CLIP
DIRECT
LncBasev2
11:65440126-65440165
exon
HITS-CLIP
DIRECT
LncBasev2
11:65433137-65433165
exon
HITS-CLIP
DIRECT
LncBasev2
11:65437600-65437667
exon
HITS-CLIP
DIRECT
LncBasev2
11:65439210-65439238
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425327-65425355
exon
HITS-CLIP
DIRECT
LncBasev2
11:65432582-65432610
exon
HITS-CLIP
DIRECT
LncBasev2
11:65431684-65431712
exon
HITS-CLIP
DIRECT
LncBasev2
11:65436605-65436633
exon
HITS-CLIP
DIRECT
LncBasev2
11:65432410-65432438
exon
HITS-CLIP
DIRECT
LncBasev2
11:65435596-65435624
exon
HITS-CLIP
DIRECT
LncBasev2
11:65443420-65443448
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-641
IP

Gene Details
Chromosome: 11
Transcript: NR_028272.1
Biotype: lincRNA
Gene id: NR_028272.1 (gene)
Gene Name: NEAT1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
11:65425737-65425765
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425646-65425674
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425327-65425355
exon
HITS-CLIP
DIRECT
LncBasev2
11:65426200-65426228
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425646-65425674
exon
HITS-CLIP
DIRECT
LncBasev2
11:65426200-65426228
exon
HITS-CLIP
DIRECT
LncBasev2
11:65426200-65426228
exon
HITS-CLIP
DIRECT
LncBasev2
11:65426200-65426228
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425327-65425355
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425646-65425674
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425737-65425765
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425327-65425355
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425646-65425674
exon
HITS-CLIP
DIRECT
LncBasev2
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
11:65425737-65425765
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65425327-65425355
exon
HITS-CLIP
DIRECT
LncBasev2
OIP5-AS1
hsa-miR-641
IP

Gene Details
Chromosome: 15
Transcript: ENST00000500949
Biotype: antisense
Gene id: ENSG00000247556
Gene Name: OIP5-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
15:41306069-41306097
exon
HITS-CLIP
DIRECT
LncBasev2
15:41300569-41300597
exon
HITS-CLIP
DIRECT
LncBasev2
15:41300885-41300913
exon
HITS-CLIP
DIRECT
LncBasev2
15:41300569-41300597
exon
HITS-CLIP
DIRECT
LncBasev2
15:41300569-41300597
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: EF3DAGO2
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:41300569-41300597
exon
PAR-CLIP
DIRECT
LncBasev2
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
15:41300569-41300597
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:41298406-41298434
exon
HITS-CLIP
DIRECT
LncBasev2
OIP5-AS1
hsa-miR-641
IP

Gene Details
Chromosome: 15
Transcript: NR_026757.1
Biotype: lincRNA
Gene id: NR_026757.1 (gene)
Gene Name: OIP5-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:41298406-41298434
exon
HITS-CLIP
DIRECT
LncBasev2
RALY-AS1
hsa-miR-641
IP

Gene Details
Chromosome: 20
Transcript: ENST00000440595
Biotype: lincRNA
Gene id: ENSG00000228265
Gene Name: RALY-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:33992490-33992518
exon
HITS-CLIP
DIRECT
LncBasev2
RANP1
hsa-miR-641
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000455094
Biotype: processed_pseudogene
Gene id: ENSG00000236603
Gene Name: RANP1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:30486325-30486353
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-102L12.2
hsa-miR-641
IP

Gene Details
Chromosome: 15
Transcript: ENST00000560231
Biotype: antisense
Gene id: ENSG00000259326
Gene Name: RP11-102L12.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:38504471-38504499
exon
HITS-CLIP
DIRECT
LncBasev2
15:38504503-38504531
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-138A9.1
hsa-miR-641
IP

Gene Details
Chromosome: 7
Transcript: ENST00000605249
Biotype: lincRNA
Gene id: ENSG00000271204
Gene Name: RP11-138A9.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
hMSC-BM Bone Marrow Stem/Progenitor
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:130931703-130931739
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: