Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-641

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
RP11-145M9.4
hsa-miR-641
IP

Gene Details
Chromosome: 3
Transcript: ENST00000595265
Biotype: lincRNA
Gene id: ENSG00000269728
Gene Name: RP11-145M9.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
3:179396676-179396704
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-159D12.2
hsa-miR-641
IP

Gene Details
Chromosome: 17
Transcript: ENST00000577267
Biotype: lincRNA
Gene id: ENSG00000264112
Gene Name: RP11-159D12.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:57990662-57990704
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-16C1.2
hsa-miR-641
IP

Gene Details
Chromosome: 17
Transcript: ENST00000578539
Biotype: sense_intronic
Gene id: ENSG00000264853
Gene Name: RP11-16C1.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:75372507-75372535
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-288H12.4
hsa-miR-641
IP

Gene Details
Chromosome: 6
Transcript: ENST00000604521
Biotype: lincRNA
Gene id: ENSG00000270949
Gene Name: RP11-288H12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
6:160110051-160110079
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-356O22.4
hsa-miR-641
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000548858
Biotype: processed_pseudogene
Gene id: ENSG00000258271
Gene Name: RP11-356O22.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
12:93529773-93529801
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-372E1.4
hsa-miR-641
IP

Gene Details
Chromosome: 3
Transcript: ENST00000476385
Biotype: antisense
Gene id: ENSG00000243818
Gene Name: RP11-372E1.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Liver Normal/Primary

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
3:142941834-142941862
exon
HITS-CLIP
DIRECT
LncBasev2
3:142941834-142941862
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-379H18.1
hsa-miR-641
IP

Gene Details
Chromosome: 7
Transcript: ENST00000605778
Biotype: antisense
Gene id: ENSG00000271122
Gene Name: RP11-379H18.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:35697409-35697437
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-405A12.1
hsa-miR-641
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000414406
Biotype: processed_pseudogene
Gene id: ENSG00000256849
Gene Name: RP11-405A12.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
12:19941816-19941844
exon
HITS-CLIP
DIRECT
LncBasev2
12:19941816-19941844
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:19941816-19941844
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-423H2.1
hsa-miR-641
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000506672
Biotype: processed_transcript
Gene id: ENSG00000170089
Gene Name: RP11-423H2.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:177884070-177884098
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-431M7.3
hsa-miR-641
-
IP

Gene Details
Chromosome: 4
Transcript: ENST00000499292
Biotype: antisense
Gene id: ENSG00000247193
Gene Name: RP11-431M7.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
4:36273789-36273817
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-448A19.1
hsa-miR-641
IP

Gene Details
Chromosome: 7
Transcript: ENST00000608694
Biotype: lincRNA
Gene id: ENSG00000273329
Gene Name: RP11-448A19.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
7:129607560-129607588
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-474P12.3
hsa-miR-641
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000411625
Biotype: processed_pseudogene
Gene id: ENSG00000177736
Gene Name: RP11-474P12.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
9:124968531-124968559
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-507K2.6
hsa-miR-641
IP

Gene Details
Chromosome: 14
Transcript: ENST00000617439
Biotype: sense_intronic
Gene id: ENSG00000278576
Gene Name: RP11-507K2.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:88592223-88592251
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-535A5.1
hsa-miR-641
IP

Gene Details
Chromosome: 18
Transcript: ENST00000608890
Biotype: lincRNA
Gene id: ENSG00000273348
Gene Name: RP11-535A5.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBACD3
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
18:22347916-22347944
exon
PAR-CLIP
DIRECT
LncBasev2
RP11-582E3.6
hsa-miR-641
IP

Gene Details
Chromosome: 12
Transcript: ENST00000620519
Biotype: lincRNA
Gene id: ENSG00000275764
Gene Name: RP11-582E3.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:27038740-27038768
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-592N21.2
hsa-miR-641
IP

Gene Details
Chromosome: 15
Transcript: ENST00000562681
Biotype: sense_intronic
Gene id: ENSG00000260586
Gene Name: RP11-592N21.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:71348425-71348453
exon
HITS-CLIP
DIRECT
LncBasev2
RP1-168P16.2
hsa-miR-641
IP

Gene Details
Chromosome: 16
Transcript: ENST00000562211
Biotype: sense_intronic
Gene id: ENSG00000261574
Gene Name: RP1-168P16.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
16:89412515-89412543
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-705C15.2
hsa-miR-641
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000575094
Biotype: processed_transcript
Gene id: ENSG00000256594
Gene Name: RP11-705C15.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
12:9657884-9657912
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-717D12.1
hsa-miR-641
IP

Gene Details
Chromosome: 3
Transcript: ENST00000398957
Biotype: sense_intronic
Gene id: ENSG00000214773
Gene Name: RP11-717D12.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:47604401-47604429
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-73M18.8
hsa-miR-641
IP

Gene Details
Chromosome: 14
Transcript: ENST00000602422
Biotype: sense_intronic
Gene id: ENSG00000269958
Gene Name: RP11-73M18.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:103696601-103696629
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: