Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-641

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
STAG3L5P
hsa-miR-641
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000493499
Biotype: processed_transcript
Gene id: ENSG00000242294
Gene Name: STAG3L5P
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:100349697-100349725
exon
HITS-CLIP
DIRECT
LncBasev2
THTPA
hsa-miR-641
IP

Gene Details
Chromosome: 14
Transcript: ENST00000553985
Biotype: antisense
Gene id: ENSG00000157306
Gene Name: THTPA
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
14:23559889-23559917
exon
HITS-CLIP
DIRECT
LncBasev2
UPF3AP1
hsa-miR-641
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000413731
Biotype: processed_pseudogene
Gene id: ENSG00000226478
Gene Name: UPF3AP1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:16746649-16746677
exon
HITS-CLIP
DIRECT
LncBasev2
XIST
hsa-miR-641
IP

Gene Details
Chromosome: X
Transcript: ENST00000429829
Biotype: lincRNA
Gene id: ENSG00000229807
Gene Name: XIST
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
X:73850924-73850952
exon
HITS-CLIP
DIRECT
LncBasev2
X:73848224-73848252
exon
HITS-CLIP
DIRECT
LncBasev2
X:73827951-73827979
exon
HITS-CLIP
DIRECT
LncBasev2
X:73820791-73820819
exon
HITS-CLIP
DIRECT
LncBasev2
X:73851003-73851031
exon
HITS-CLIP
DIRECT
LncBasev2
X:73847551-73847579
exon
HITS-CLIP
DIRECT
LncBasev2
X:73824158-73824186
exon
HITS-CLIP
DIRECT
LncBasev2
X:73843911-73843939
exon
HITS-CLIP
DIRECT
LncBasev2
X:73827827-73827855
exon
HITS-CLIP
DIRECT
LncBasev2
X:73847551-73847579
exon
HITS-CLIP
DIRECT
LncBasev2
X:73848224-73848252
exon
HITS-CLIP
DIRECT
LncBasev2
X:73851327-73851355
exon
HITS-CLIP
DIRECT
LncBasev2
X:73849313-73849341
exon
HITS-CLIP
DIRECT
LncBasev2
X:73851003-73851031
exon
HITS-CLIP
DIRECT
LncBasev2
X:73820791-73820819
exon
HITS-CLIP
DIRECT
LncBasev2
X:73847551-73847579
exon
HITS-CLIP
DIRECT
LncBasev2
X:73848898-73848926
exon
HITS-CLIP
DIRECT
LncBasev2
X:73847640-73847668
exon
HITS-CLIP
DIRECT
LncBasev2
X:73851327-73851355
exon
HITS-CLIP
DIRECT
LncBasev2
X:73848374-73848402
exon
HITS-CLIP
DIRECT
LncBasev2
X:73849313-73849341
exon
HITS-CLIP
DIRECT
LncBasev2
X:73851003-73851031
exon
HITS-CLIP
DIRECT
LncBasev2
X:73820791-73820819
exon
HITS-CLIP
DIRECT
LncBasev2
X:73848224-73848252
exon
HITS-CLIP
DIRECT
LncBasev2
X:73827951-73827979
exon
HITS-CLIP
DIRECT
LncBasev2
X:73847551-73847579
exon
HITS-CLIP
DIRECT
LncBasev2
X:73849313-73849341
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_001414
hsa-miR-641
IP

Gene Details
Chromosome: chr2
Transcript: TCONS_00003624
Biotype: transcript isomorph
Gene id: XLOC_001414
Gene Name: XLOC_001414
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Breast Normal/Primary
- Testes Normal/Primary

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
chr2:30823766-30823794
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_001457
hsa-miR-641
IP

Gene Details
Chromosome: chr2
Transcript: TCONS_00004782
Biotype: transcript isomorph
Gene id: XLOC_001457
Gene Name: XLOC_001457
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
chr2:46647624-46647652
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_003416
hsa-miR-641
IP

Gene Details
Chromosome: chr4
Transcript: TCONS_00007951
Biotype: transcript isomorph
Gene id: XLOC_003416
Gene Name: XLOC_003416
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
chr4:1008800-1008828
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_005677
hsa-miR-641
IP

Gene Details
Chromosome: chr6
Transcript: TCONS_00012690
Biotype: transcript isomorph
Gene id: XLOC_005677
Gene Name: XLOC_005677
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
A549 Lung Cancer/Malignant
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
chr6:31171752-31171780
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_008207
hsa-miR-641
IP

Gene Details
Chromosome: chrX
Transcript: TCONS_00017361
Biotype: transcript isomorph
Gene id: XLOC_008207
Gene Name: XLOC_008207
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Colon Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
chrX:108720111-108720139
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_009868
hsa-miR-641
IP

Gene Details
Chromosome: chr12
Transcript: TCONS_00020555
Biotype: transcript isomorph
Gene id: XLOC_009868
Gene Name: XLOC_009868
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
chr12:105411642-105411670
exon
HITS-CLIP
DIRECT
LncBasev2
ZNF37BP
hsa-miR-641
-
IP

Gene Details
Chromosome: 10
Transcript: ENST00000452075
Biotype: processed_transcript
Gene id: ENSG00000234420
Gene Name: ZNF37BP
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
10:42552011-42552039
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: