Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-642b-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
PCAT19
hsa-miR-642b-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000588495
Biotype: lincRNA
Gene id: ENSG00000267107
Gene Name: PCAT19
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:41454406-41454434
exon
HITS-CLIP
DIRECT
LncBasev2
PCBP1-AS1
hsa-miR-642b-3p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000416395
Biotype: antisense
Gene id: ENSG00000179818
Gene Name: PCBP1-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:70051265-70051293
exon
HITS-CLIP
DIRECT
LncBasev2
RBMS2P1
hsa-miR-642b-3p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000525031
Biotype: processed_pseudogene
Gene id: ENSG00000213250
Gene Name: RBMS2P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:94424739-94424767
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-234A1.1
hsa-miR-642b-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000496294
Biotype: processed_pseudogene
Gene id: ENSG00000242299
Gene Name: RP11-234A1.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:101576501-101576529
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-492E3.51
hsa-miR-642b-3p
IP

Gene Details
Chromosome: 9
Transcript: ENST00000427778
Biotype: lincRNA
Gene id: ENSG00000239353
Gene Name: RP11-492E3.51
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:129502055-129502083
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-507K2.6
hsa-miR-642b-3p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000617439
Biotype: sense_intronic
Gene id: ENSG00000278576
Gene Name: RP11-507K2.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:88592221-88592249
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-73M18.8
hsa-miR-642b-3p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000602422
Biotype: sense_intronic
Gene id: ENSG00000269958
Gene Name: RP11-73M18.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:103696599-103696627
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-96D1.10
hsa-miR-642b-3p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000571975
Biotype: sense_overlapping
Gene id: ENSG00000263276
Gene Name: RP11-96D1.10
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:68226976-68227004
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-98I9.4
hsa-miR-642b-3p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000418945
Biotype: antisense
Gene id: ENSG00000228506
Gene Name: RP11-98I9.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:99431314-99431342
exon
HITS-CLIP
DIRECT
LncBasev2
RPL4P4
hsa-miR-642b-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000422486
Biotype: processed_pseudogene
Gene id: ENSG00000229638
Gene Name: RPL4P4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:185418489-185418517
exon
HITS-CLIP
DIRECT
LncBasev2
RPS13P2
hsa-miR-642b-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000437890
Biotype: processed_pseudogene
Gene id: ENSG00000228929
Gene Name: RPS13P2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:52772186-52772214
exon
HITS-CLIP
DIRECT
LncBasev2
SNHG23
hsa-miR-642b-3p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000414488
Biotype: lincRNA
Gene id: ENSG00000225746
Gene Name: SNHG23
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:100949555-100949583
exon
HITS-CLIP
DIRECT
LncBasev2
SNHG24
hsa-miR-642b-3p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000554693
Biotype: lincRNA
Gene id: ENSG00000271417
Gene Name: SNHG24
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:100987072-100987100
exon
HITS-CLIP
DIRECT
LncBasev2
SVIL-AS1
hsa-miR-642b-3p
IP

Gene Details
Chromosome: 10
Transcript: ENST00000427063
Biotype: antisense
Gene id: ENSG00000224597
Gene Name: SVIL-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:29421196-29421224
exon
HITS-CLIP
DIRECT
LncBasev2
TUB-AS1
hsa-miR-642b-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000506601
Biotype: sense_intronic
Gene id: ENSG00000248332
Gene Name: TUB-AS1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:8068772-8068800
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_009511
hsa-miR-642b-3p
IP

Gene Details
Chromosome: chr11
Transcript: TCONS_00020103
Biotype: transcript isomorph
Gene id: XLOC_009511
Gene Name: XLOC_009511
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Ovary Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary

miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
chr11:77571233-77571261
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: