Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-99b-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
HOXA10-HOXA9
hsa-miR-99b-3p
IP

Gene Details
Chromosome: 7
Transcript: NR_037940.1
Biotype: sense
Gene id: NR_037940.1 (gene)
Gene Name: HOXA10-HOXA9
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:27163315-27163343
exon
HITS-CLIP
DIRECT
LncBasev2
HSP90AB2P
hsa-miR-99b-3p
-
IP

Gene Details
Chromosome: 4
Transcript: ENST00000507090
Biotype: transcribed_processed_pseudogene
Gene id: ENSG00000205940
Gene Name: HSP90AB2P
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
4:13337766-13337794
exon
HITS-CLIP
DIRECT
LncBasev2
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
4:13337766-13337794
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:13337766-13337794
exon
PAR-CLIP
DIRECT
LncBasev2
INMT-FAM188B
hsa-miR-99b-3p
-
IP

Gene Details
Chromosome: 7
Transcript: NR_037598.1
Biotype: sense
Gene id: NR_037598.1 (gene)
Gene Name: INMT-FAM188B
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30882934-30882962
exon
HITS-CLIP
DIRECT
LncBasev2
INTS6-AS1
hsa-miR-99b-3p
IP

Gene Details
Chromosome: 13
Transcript: ENST00000598905
Biotype: antisense
Gene id: ENSG00000236778
Gene Name: INTS6-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
13:51454695-51454723
exon
HITS-CLIP
DIRECT
LncBasev2
INTS6-AS1
hsa-miR-99b-3p
IP

Gene Details
Chromosome: 13
Transcript: NR_103812.1
Biotype: antisense
Gene id: NR_103812.1 (gene)
Gene Name: INTS6-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
13:51454695-51454723
exon
HITS-CLIP
DIRECT
LncBasev2
KCNQ1OT1
hsa-miR-99b-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:2654899-2654927
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00910
hsa-miR-99b-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000586231
Biotype: lincRNA
Gene id: ENSG00000188825
Gene Name: LINC00910
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:43387286-43387314
exon
HITS-CLIP
DIRECT
LncBasev2
17:43387286-43387314
exon
HITS-CLIP
DIRECT
LncBasev2
LOC100289495
hsa-miR-99b-3p
IP

Gene Details
Chromosome: 6
Transcript: NR_040022.1
Biotype: lincRNA
Gene id: NR_040022.1 (gene)
Gene Name: LOC100289495
UCSC graphic: -
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:166350430-166350458
exon
HITS-CLIP
DIRECT
LncBasev2
LOC100506281
hsa-miR-99b-3p
IP

Gene Details
Chromosome: 16
Transcript: NR_109777.1
Biotype: antisense
Gene id: NR_109777.1 (gene)
Gene Name: LOC100506281
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:75226933-75226961
exon
HITS-CLIP
DIRECT
LncBasev2
LYPLA1P3
hsa-miR-99b-3p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000402650
Biotype: processed_pseudogene
Gene id: ENSG00000218350
Gene Name: LYPLA1P3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
6:71165419-71165447
exon
HITS-CLIP
DIRECT
LncBasev2
6:71165419-71165447
exon
HITS-CLIP
DIRECT
LncBasev2
6:71165419-71165447
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HMSC
Category: Stem/Progenitor
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:71165419-71165447
exon
HITS-CLIP
DIRECT
LncBasev2
MAGOH2
hsa-miR-99b-3p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000580926
Biotype: transcribed_processed_pseudogene
Gene id: ENSG00000264176
Gene Name: MAGOH2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:10716249-10716277
exon
HITS-CLIP
DIRECT
LncBasev2
MALAT1
hsa-miR-99b-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000534336
Biotype: lincRNA
Gene id: ENSG00000251562
Gene Name: MALAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
11:65500045-65500073
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504954-65504982
exon
HITS-CLIP
DIRECT
LncBasev2
11:65502546-65502574
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505599-65505627
exon
HITS-CLIP
DIRECT
LncBasev2
11:65502135-65502163
exon
HITS-CLIP
DIRECT
LncBasev2
11:65499070-65499098
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501751-65501779
exon
HITS-CLIP
DIRECT
LncBasev2
11:65502135-65502163
exon
HITS-CLIP
DIRECT
LncBasev2
11:65499070-65499098
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505599-65505627
exon
HITS-CLIP
DIRECT
LncBasev2
11:65500045-65500073
exon
HITS-CLIP
DIRECT
LncBasev2
11:65502546-65502574
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501751-65501779
exon
HITS-CLIP
DIRECT
LncBasev2
11:65502546-65502574
exon
HITS-CLIP
DIRECT
LncBasev2
11:65499070-65499098
exon
HITS-CLIP
DIRECT
LncBasev2
11:65502135-65502163
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505599-65505627
exon
HITS-CLIP
DIRECT
LncBasev2
11:65502546-65502574
exon
HITS-CLIP
DIRECT
LncBasev2
11:65500045-65500073
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505599-65505627
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501751-65501779
exon
HITS-CLIP
DIRECT
LncBasev2
11:65499070-65499098
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501751-65501779
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505599-65505627
exon
HITS-CLIP
DIRECT
LncBasev2
11:65499070-65499098
exon
HITS-CLIP
DIRECT
LncBasev2
11:65502135-65502163
exon
HITS-CLIP
DIRECT
LncBasev2
11:65500045-65500073
exon
HITS-CLIP
DIRECT
LncBasev2
11:65502546-65502574
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65499070-65499098
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65504954-65504982
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505599-65505627
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501751-65501779
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501751-65501779
exon
HITS-CLIP
DIRECT
LncBasev2
11:65502546-65502574
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505599-65505627
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504954-65504982
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
MDAMB231
IP
Tested Cell Line: MDAMB231
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65505599-65505627
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501751-65501779
exon
HITS-CLIP
DIRECT
LncBasev2
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
11:65504954-65504982
exon
HITS-CLIP
DIRECT
LncBasev2
MEG3
hsa-miR-99b-3p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000522771
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:100830956-100830984
exon
HITS-CLIP
DIRECT
LncBasev2
MIR7-3HG
hsa-miR-99b-3p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000586721
Biotype: lincRNA
Gene id: ENSG00000176840
Gene Name: MIR7-3HG
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:4772139-4772167
exon
HITS-CLIP
DIRECT
LncBasev2
MYO15B
hsa-miR-99b-3p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000582561
Biotype: processed_transcript
Gene id: ENSG00000266714
Gene Name: MYO15B
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:75590865-75590893
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-99b-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
11:65424432-65424460
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424924-65424952
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424924-65424952
exon
HITS-CLIP
DIRECT
LncBasev2
11:65437920-65437948
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424924-65424952
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424432-65424460
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424432-65424460
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424924-65424952
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424432-65424460
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65424432-65424460
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65443971-65443999
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-99b-3p
IP

Gene Details
Chromosome: 11
Transcript: NR_028272.1
Biotype: lincRNA
Gene id: NR_028272.1 (gene)
Gene Name: NEAT1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
11:65424432-65424460
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424432-65424460
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424924-65424952
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424924-65424952
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424432-65424460
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424924-65424952
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424432-65424460
exon
HITS-CLIP
DIRECT
LncBasev2
11:65424924-65424952
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65424432-65424460
exon
HITS-CLIP
DIRECT
LncBasev2
NFYC-AS1
hsa-miR-99b-3p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000606277
Biotype: antisense
Gene id: ENSG00000272145
Gene Name: NFYC-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:40691433-40691461
exon
HITS-CLIP
DIRECT
LncBasev2
PLEKHM1P
hsa-miR-99b-3p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000397718
Biotype: processed_transcript
Gene id: ENSG00000214176
Gene Name: PLEKHM1P
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:64820287-64820315
exon
HITS-CLIP
DIRECT
LncBasev2
PSMA2P3
hsa-miR-99b-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000429685
Biotype: processed_pseudogene
Gene id: ENSG00000227890
Gene Name: PSMA2P3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:202179728-202179756
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: