Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-99b-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
PVT1
hsa-miR-99b-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000513868
Biotype: lincRNA
Gene id: ENSG00000249859
Gene Name: PVT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
8:127890636-127890664
exon
HITS-CLIP
DIRECT
LncBasev2
PWARSN
hsa-miR-99b-3p
IP

Gene Details
Chromosome: 15
Transcript: NR_022011.1
Biotype: sense
Gene id: NR_022011.1 (gene)
Gene Name: PWARSN
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:24982021-24982049
exon
HITS-CLIP
DIRECT
LncBasev2
RALGAPA1P
hsa-miR-99b-3p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000443361
Biotype: processed_pseudogene
Gene id: ENSG00000229419
Gene Name: RALGAPA1P
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:105521793-105521821
exon
HITS-CLIP
DIRECT
LncBasev2
RNGTTP1
hsa-miR-99b-3p
-
IP

Gene Details
Chromosome: 21
Transcript: ENST00000420965
Biotype: processed_pseudogene
Gene id: ENSG00000237731
Gene Name: RNGTTP1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
21:25643821-25643849
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-1033A18.1
hsa-miR-99b-3p
-
IP

Gene Details
Chromosome: 11
Transcript: ENST00000530115
Biotype: processed_pseudogene
Gene id: ENSG00000224411
Gene Name: RP11-1033A18.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:27890842-27890870
exon
HITS-CLIP
DIRECT
LncBasev2
11:27890842-27890870
exon
HITS-CLIP
DIRECT
LncBasev2
11:27889695-27889723
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-109P14.2
hsa-miR-99b-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000417484
Biotype: processed_pseudogene
Gene id: ENSG00000227416
Gene Name: RP11-109P14.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
1:37782838-37782866
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-137J7.3
hsa-miR-99b-3p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000604304
Biotype: processed_pseudogene
Gene id: ENSG00000270983
Gene Name: RP11-137J7.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:142063002-142063030
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-14C22.6
hsa-miR-99b-3p
IP

Gene Details
Chromosome: 10
Transcript: ENST00000416310
Biotype: lincRNA
Gene id: ENSG00000230720
Gene Name: RP11-14C22.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
10:30723445-30723473
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-174G6.5
hsa-miR-99b-3p
IP

Gene Details
Chromosome: 12
Transcript: ENST00000562691
Biotype: sense_overlapping
Gene id: ENSG00000261324
Gene Name: RP11-174G6.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:14762861-14762889
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-175O19.4
hsa-miR-99b-3p
IP

Gene Details
Chromosome: 10
Transcript: ENST00000421806
Biotype: antisense
Gene id: ENSG00000231025
Gene Name: RP11-175O19.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
10:96995764-96995792
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-272L14.2
hsa-miR-99b-3p
IP

Gene Details
Chromosome: 13
Transcript: ENST00000614612
Biotype: sense_intronic
Gene id: ENSG00000274204
Gene Name: RP11-272L14.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
13:106506504-106506532
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-296P7.4
hsa-miR-99b-3p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000441073
Biotype: processed_pseudogene
Gene id: ENSG00000236680
Gene Name: RP11-296P7.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
9:19027745-19027773
exon
HITS-CLIP
DIRECT
LncBasev2
9:19027745-19027773
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-314C16.1
hsa-miR-99b-3p
IP

Gene Details
Chromosome: 6
Transcript: NR_038979.1
Biotype: lincRNA
Gene id: NR_038979.1 (gene)
Gene Name: RP11-314C16.1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:8436009-8436037
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-331F4.4
hsa-miR-99b-3p
-
IP

Gene Details
Chromosome: 16
Transcript: ENST00000489723
Biotype: processed_transcript
Gene id: ENSG00000240338
Gene Name: RP11-331F4.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:75226933-75226961
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-356M20.3
hsa-miR-99b-3p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000558749
Biotype: sense_intronic
Gene id: ENSG00000259735
Gene Name: RP11-356M20.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:59348674-59348702
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-435F17.3
hsa-miR-99b-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000478867
Biotype: processed_pseudogene
Gene id: ENSG00000241889
Gene Name: RP11-435F17.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
3:113885650-113885678
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-438B23.2
hsa-miR-99b-3p
IP

Gene Details
Chromosome: 9
Transcript: ENST00000566293
Biotype: sense_overlapping
Gene id: ENSG00000260412
Gene Name: RP11-438B23.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:27941123-27941151
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-458J1.1
hsa-miR-99b-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000619697
Biotype: antisense
Gene id: ENSG00000278834
Gene Name: RP11-458J1.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
17:40649296-40649324
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-480A16.1
hsa-miR-99b-3p
IP

Gene Details
Chromosome: 3
Transcript: ENST00000570130
Biotype: lincRNA
Gene id: ENSG00000260261
Gene Name: RP11-480A16.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
3:195950848-195950876
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-489M13.1
hsa-miR-99b-3p
-
IP

Gene Details
Chromosome: 4
Transcript: ENST00000485355
Biotype: processed_pseudogene
Gene id: ENSG00000243894
Gene Name: RP11-489M13.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:4076812-4076840
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: