Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-99b-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
WWP1P1
hsa-miR-99b-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000466609
Biotype: processed_pseudogene
Gene id: ENSG00000244153
Gene Name: WWP1P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
3:98658966-98658994
exon
HITS-CLIP
DIRECT
LncBasev2
XIST
hsa-miR-99b-3p
IP

Gene Details
Chromosome: X
Transcript: ENST00000429829
Biotype: lincRNA
Gene id: ENSG00000229807
Gene Name: XIST
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
X:73851661-73851689
exon
HITS-CLIP
DIRECT
LncBasev2
X:73826116-73826144
exon
HITS-CLIP
DIRECT
LncBasev2
X:73847221-73847249
exon
HITS-CLIP
DIRECT
LncBasev2
X:73851661-73851689
exon
HITS-CLIP
DIRECT
LncBasev2
X:73849576-73849604
exon
HITS-CLIP
DIRECT
LncBasev2
X:73822267-73822295
exon
HITS-CLIP
DIRECT
LncBasev2
X:73849576-73849604
exon
HITS-CLIP
DIRECT
LncBasev2
X:73826116-73826144
exon
HITS-CLIP
DIRECT
LncBasev2
X:73851661-73851689
exon
HITS-CLIP
DIRECT
LncBasev2
X:73847221-73847249
exon
HITS-CLIP
DIRECT
LncBasev2
X:73822267-73822295
exon
HITS-CLIP
DIRECT
LncBasev2
X:73848486-73848514
exon
HITS-CLIP
DIRECT
LncBasev2
X:73849576-73849604
exon
HITS-CLIP
DIRECT
LncBasev2
X:73822267-73822295
exon
HITS-CLIP
DIRECT
LncBasev2
X:73826116-73826144
exon
HITS-CLIP
DIRECT
LncBasev2
X:73824705-73824733
exon
HITS-CLIP
DIRECT
LncBasev2
X:73825150-73825178
exon
HITS-CLIP
DIRECT
LncBasev2
X:73847221-73847249
exon
HITS-CLIP
DIRECT
LncBasev2
X:73851661-73851689
exon
HITS-CLIP
DIRECT
LncBasev2
X:73822267-73822295
exon
HITS-CLIP
DIRECT
LncBasev2
X:73847221-73847249
exon
HITS-CLIP
DIRECT
LncBasev2
X:73851661-73851689
exon
HITS-CLIP
DIRECT
LncBasev2
X:73826116-73826144
exon
HITS-CLIP
DIRECT
LncBasev2
X:73822267-73822295
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_008207
hsa-miR-99b-3p
IP

Gene Details
Chromosome: chrX
Transcript: TCONS_00017361
Biotype: transcript isomorph
Gene id: XLOC_008207
Gene Name: XLOC_008207
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Colon Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
chrX:108721249-108721277
exon
HITS-CLIP
DIRECT
LncBasev2
chrX:108721249-108721277
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_012314
hsa-miR-99b-3p
IP

Gene Details
Chromosome: chr17
Transcript: TCONS_00025499
Biotype: transcript isomorph
Gene id: XLOC_012314
Gene Name: XLOC_012314
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
chr17:76834929-76834957
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_012382
hsa-miR-99b-3p
IP

Gene Details
Chromosome: chr17
Transcript: TCONS_00025133
Biotype: transcript isomorph
Gene id: XLOC_012382
Gene Name: XLOC_012382
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
- Liver Normal/Primary
A549 Lung Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
chr17:7869327-7869355
exon
HITS-CLIP
DIRECT
LncBasev2
ZFAS1
hsa-miR-99b-3p
IP

Gene Details
Chromosome: 20
Transcript: ENST00000623640
Biotype: antisense
Gene id: ENSG00000177410
Gene Name: ZFAS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:49281101-49281129
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: