Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-99b-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
RP11-661A12.4
hsa-miR-99b-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000517300
Biotype: antisense
Gene id: ENSG00000254144
Gene Name: RP11-661A12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
hMSC-BM Bone Marrow Stem/Progenitor
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:143542166-143542194
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-710M11.1
hsa-miR-99b-5p
-
IP

Gene Details
Chromosome: 18
Transcript: ENST00000577490
Biotype: processed_pseudogene
Gene id: ENSG00000266373
Gene Name: RP11-710M11.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
18:3580186-3580214
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-730G20.2
hsa-miR-99b-5p
-
IP

Gene Details
Chromosome: 8
Transcript: ENST00000517662
Biotype: processed_pseudogene
Gene id: ENSG00000253341
Gene Name: RP11-730G20.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:74603305-74603333
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:74603305-74603333
exon
HITS-CLIP
DIRECT
LncBasev2
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:74603305-74603333
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-734K2.4
hsa-miR-99b-5p
IP

Gene Details
Chromosome: 12
Transcript: ENST00000605233
Biotype: antisense
Gene id: ENSG00000270344
Gene Name: RP11-734K2.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: TZMBL
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:89541917-89541945
exon
HITS-CLIP
DIRECT
LncBasev2
RP1-178F15.5
hsa-miR-99b-5p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000497086
Biotype: processed_transcript
Gene id: ENSG00000271853
Gene Name: RP1-178F15.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: TZMBL
Category: Cancer/Malignant
Experimental Condition: shRNs against HIV-1
Location
Region
Method
Result
Validation Type
Source
1:153627480-153627508
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-923I11.6
hsa-miR-99b-5p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000562343
Biotype: lincRNA
Gene id: ENSG00000261586
Gene Name: RP11-923I11.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:51820141-51820169
exon
HITS-CLIP
DIRECT
LncBasev2
RP13-347D8.1
hsa-miR-99b-5p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000443421
Biotype: processed_pseudogene
Gene id: ENSG00000231270
Gene Name: RP13-347D8.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
X:118938893-118938921
exon
HITS-CLIP
DIRECT
LncBasev2
RP3-368A4.6
hsa-miR-99b-5p
IP

Gene Details
Chromosome: X
Transcript: ENST00000604070
Biotype: sense_intronic
Gene id: ENSG00000271533
Gene Name: RP3-368A4.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:74211705-74211733
exon
HITS-CLIP
DIRECT
LncBasev2
X:74210527-74210555
exon
HITS-CLIP
DIRECT
LncBasev2
RPL14P1
hsa-miR-99b-5p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000484568
Biotype: processed_pseudogene
Gene id: ENSG00000139239
Gene Name: RPL14P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:62965332-62965360
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:62965332-62965360
exon
HITS-CLIP
DIRECT
LncBasev2
RPL15P3
hsa-miR-99b-5p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000391491
Biotype: processed_pseudogene
Gene id: ENSG00000212802
Gene Name: RPL15P3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:12514316-12514344
exon
HITS-CLIP
DIRECT
LncBasev2
RPL3P4
hsa-miR-99b-5p
-
IP

Gene Details
Chromosome: 14
Transcript: ENST00000417615
Biotype: processed_pseudogene
Gene id: ENSG00000232573
Gene Name: RPL3P4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:98973059-98973087
exon
HITS-CLIP
DIRECT
LncBasev2
RPL4P4
hsa-miR-99b-5p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000422486
Biotype: processed_pseudogene
Gene id: ENSG00000229638
Gene Name: RPL4P4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:185417726-185417754
exon
HITS-CLIP
DIRECT
LncBasev2
RTEL1-TNFRSF6B
hsa-miR-99b-5p
IP

Gene Details
Chromosome: 20
Transcript: NR_037882.1
Biotype: sense
Gene id: NR_037882.1 (gene)
Gene Name: RTEL1-TNFRSF6B
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
20:63661303-63661331
exon
HITS-CLIP
DIRECT
LncBasev2
SNHG22
hsa-miR-99b-5p
IP

Gene Details
Chromosome: 18
Transcript: ENST00000615535
Biotype: antisense
Gene id: ENSG00000267322
Gene Name: SNHG22
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
18:49814278-49814306
exon
HITS-CLIP
DIRECT
LncBasev2
SNHG8
hsa-miR-99b-5p
IP

Gene Details
Chromosome: 4
Transcript: ENST00000602414
Biotype: lincRNA
Gene id: ENSG00000269893
Gene Name: SNHG8
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:118279676-118279704
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:118279676-118279704
exon
HITS-CLIP
DIRECT
LncBasev2
SNHG8
hsa-miR-99b-5p
IP

Gene Details
Chromosome: 4
Transcript: NR_003584.3
Biotype: lincRNA
Gene id: NR_003584.3 (gene)
Gene Name: SNHG8
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:118279676-118279704
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:118279676-118279704
exon
HITS-CLIP
DIRECT
LncBasev2
TMSB10P2
hsa-miR-99b-5p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000416049
Biotype: processed_pseudogene
Gene id: ENSG00000235211
Gene Name: TMSB10P2
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
X:18341307-18341335
exon
HITS-CLIP
DIRECT
LncBasev2
TMX2-CTNND1
hsa-miR-99b-5p
IP

Gene Details
Chromosome: 11
Transcript: NR_037646.1
Biotype: sense
Gene id: NR_037646.1 (gene)
Gene Name: TMX2-CTNND1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:57808448-57808476
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
MDAMB231
IP
Tested Cell Line: MDAMB231
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:57808448-57808476
exon
HITS-CLIP
DIRECT
LncBasev2
TP73-AS1
hsa-miR-99b-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000452079
Biotype: antisense
Gene id: ENSG00000227372
Gene Name: TP73-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
1:3739524-3739552
exon
HITS-CLIP
DIRECT
LncBasev2
U91328.20
hsa-miR-99b-5p
IP

Gene Details
Chromosome: 6
Transcript: ENST00000607586
Biotype: lincRNA
Gene id: ENSG00000272065
Gene Name: U91328.20
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HEK293
Category: Embryonic/Fetal
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:25990991-25991019
exon
PAR-CLIP
DIRECT
LncBasev2
Funded by: