Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-let-7e-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
XLOC_013024
hsa-let-7e-5p
1.000

Gene Details
Chromosome: chr19
Transcript: TCONS_00026972
Biotype: transcript isomorph
Gene id: XLOC_013024
Gene Name: XLOC_013024
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
757-772
0.213
1
8mer
201-228
0.125
1
6mer
42-57
0.013
1
6mer
664-679
0.012
1
6mer
352-365
0.010
1
6mer
375-400
0.007
1
RP11-923I11.8
hsa-let-7e-5p
1.000

Gene Details
Chromosome: 12
Transcript: ENST00000618634
Biotype: antisense
Gene id: ENSG00000278451
Gene Name: RP11-923I11.8
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
142-161
0.196
14
8mer
67-93
0.119
14
9mer
319-339
0.022
4
chr22-38_28785274-29006793.1
hsa-let-7e-5p
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
120017-120029
0.027
10
8mer
231890-231916
0.015
Not Conserved
8mer
186256-186277
0.010
1
7mer
187676-187700
0.009
1
7mer
232112-232137
0.009
1
9mer
230544-230569
0.008
1
8mer
91386-91404
0.007
2
7mer
224740-224755
0.007
2
7mer
57654-57672
0.006
4
9mer
252952-252974
0.006
3
7mer
216013-216039
0.005
8
7mer
53457-53474
0.005
1
7mer
35759-35779
0.005
1
8mer
33402-33417
0.005
6
7mer
191030-191046
0.005
3
7mer
130199-130216
0.004
7
7mer
33528-33543
0.004
2
7mer
206678-206696
0.004
3
7mer
167222-167247
0.004
2
7mer
96955-96978
0.004
2
7mer
146043-146067
0.003
1
7mer
174027-174047
0.003
2
8mer
108228-108249
0.003
1
7mer
104969-104990
0.003
3
7mer
111017-111032
0.003
1
7mer
24497-24517
0.003
1
7mer
19139-19164
0.003
2
8mer
213969-213990
0.003
4
6mer
128699-128715
0.003
9
9mer
158223-158245
0.003
2
6mer
126552-126572
0.003
7
6mer
101202-101222
0.003
9
6mer
20758-20782
0.003
7
6mer
3249-3272
0.002
7
6mer
40485-40505
0.002
4
7mer
180381-180396
0.002
1
6mer
3648-3671
0.002
4
7mer
185843-185858
0.002
1
6mer
40804-40821
0.002
3
6mer
144763-144776
0.002
7
7mer
233279-233294
0.002
1
6mer
56298-56322
0.002
4
6mer
9841-9866
0.002
7
6mer
220462-220483
0.002
3
6mer
9099-9108
0.002
1
6mer
201217-201243
0.002
1
6mer
264825-264829
0.002
1
6mer
42012-42035
0.002
2
7mer
42071-42092
0.002
2
6mer
177679-177695
0.002
2
6mer
184592-184610
0.002
1
6mer
154188-154206
0.002
Not Conserved
6mer
77880-77904
0.002
1
6mer
135330-135357
0.002
4
8mer+wobble
252398-252416
0.002
4
6mer
168929-168954
0.002
2
6mer
70133-70157
0.002
4
8mer+wobble
63708-63729
0.002
1
6mer
132896-132920
0.002
1
6mer
24218-24237
0.002
3
6mer
11906-11925
0.001
2
6mer
187856-187882
0.001
2
6mer
154605-154630
0.001
2
6mer
21704-21729
0.001
3
6mer
6767-6791
0.001
2
6mer
103577-103581
0.001
2
6mer
33115-33131
0.001
2
6mer
85960-85987
0.001
2
7mer
148857-148877
0.001
1
6mer
21046-21072
0.001
3
6mer
20528-20543
0.001
Not Conserved
6mer
77398-77423
0.001
1
6mer
111742-111757
0.001
2
6mer
223922-223948
0.001
2
6mer
162135-162160
0.001
3
6mer
128405-128416
0.001
1
6mer
38793-38811
0.001
2
6mer
188465-188480
0.001
2
6mer
113797-113818
0.001
4
6mer
69706-69730
0.001
4
6mer
155156-155183
0.001
2
6mer
264482-264504
0.001
2
6mer
205653-205674
0.001
3
6mer
103896-103921
0.001
2
6mer
100864-100885
0.001
1
6mer
207983-208010
0.001
1
6mer
29052-29072
0.001
2
6mer
221012-221033
0.001
2
6mer
237469-237489
0.001
2
6mer
231490-231516
0.001
1
6mer
239932-239951
0.001
2
6mer
255486-255509
0.001
2
6mer
66538-66564
0.001
Not Conserved
6mer
68925-68946
0.001
2
6mer
52587-52612
0.001
1
6mer
59724-59736
0.001
1
6mer
143413-143435
0.001
2
6mer
205932-205955
0.001
Not Conserved
6mer
80679-80702
0.001
1
6mer
172757-172767
0.001
3
6mer
88476-88491
0.001
2
6mer
94992-95015
0.001
2
6mer
6258-6279
0.001
3
6mer
195761-195782
0.001
1
6mer
71483-71506
0.001
2
6mer
117786-117799
0.001
2
6mer
247537-247551
0.001
1
9mer
111037-111059
0.001
1
6mer
175665-175678
0.001
3
6mer
133878-133901
0.001
1
6mer
243261-243275
0.001
1
6mer
93114-93135
0.001
2
6mer
255254-255279
0.001
2
6mer
247203-247226
0.001
1
6mer
61218-61242
0.001
2
6mer
148950-148966
0.001
2
6mer
233638-233663
0.001
2
6mer
111860-111879
0.001
1
6mer
91498-91521
0.001
1
6mer
186273-186297
0.001
3
6mer
127826-127840
0.001
Not Conserved
6mer
76222-76245
0.001
2
6mer
138431-138445
0.001
1
6mer
110191-110214
0.001
2
6mer
233394-233410
0.001
2
6mer
201882-201905
0.001
Not Conserved
6mer
170124-170147
0.001
2
6mer
136571-136594
0.001
2
6mer
97259-97282
0.001
2
6mer
143619-143641
0.001
3
6mer
247648-247660
0.001
1
6mer
36892-36915
0.001
2
6mer
137454-137477
0.001
2
6mer
143481-143503
0.001
3
6mer
261366-261389
0.000
1
6mer
143560-143572
0.000
3
6mer
230559-230584
0.000
1
6mer
18988-19011
0.000
1
6mer
160983-161006
0.000
1
6mer
120053-120072
0.000
1
RP11-54G14.1
hsa-let-7e-5p
1.000

Gene Details
Chromosome: 18
Transcript: ENST00000613153
Biotype: lincRNA
Gene id: ENSG00000274918
Gene Name: RP11-54G14.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
289-311
0.180
2
AC012314.20
hsa-let-7e-5p
1.000

Gene Details
Chromosome: 19
Transcript: ENST00000426213
Biotype: lincRNA
Gene id: ENSG00000223660
Gene Name: AC012314.20
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
74-90
0.169
2
6mer
348-374
0.006
1
XLOC_012138
hsa-let-7e-5p
1.000

Gene Details
Chromosome: chr17
Transcript: TCONS_00025860
Biotype: transcript isomorph
Gene id: XLOC_012138
Gene Name: XLOC_012138
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
691-705
0.173
1
TPTEP1
hsa-let-7e-5p
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000588424
Biotype: lincRNA
Gene id: ENSG00000100181
Gene Name: TPTEP1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1326-1349
0.166
2
6mer
786-808
0.004
1
XLOC_013931
hsa-let-7e-5p
1.000

Gene Details
Chromosome: chr21
Transcript: TCONS_00028843
Biotype: transcript isomorph
Gene id: XLOC_013931
Gene Name: XLOC_013931
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
253-279
0.159
1
MEG3
hsa-let-7e-5p
1.000

Gene Details
Chromosome: 14
Transcript: ENST00000398460
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
3268-3290
0.105
6
9mer
93-120
0.048
4
LINC01287
hsa-let-7e-5p
1.000

Gene Details
Chromosome: 7
Transcript: ENST00000416982
Biotype: lincRNA
Gene id: ENSG00000234722
Gene Name: LINC01287
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
196-218
0.144
1
XLOC_013734
hsa-let-7e-5p
0.999

Gene Details
Chromosome: chr20
Transcript: TCONS_00028377
Biotype: transcript isomorph
Gene id: XLOC_013734
Gene Name: XLOC_013734
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Testes Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
229-247
0.070
2
8mer
69-82
0.051
2
6mer
63-82
0.005
2
AC026806.2
hsa-let-7e-5p
0.999

Gene Details
Chromosome: 19
Transcript: ENST00000602211
Biotype: lincRNA
Gene id: ENSG00000268913
Gene Name: AC026806.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
336-349
0.116
3
6mer
367-380
0.005
1
ERVH48-1
hsa-let-7e-5p
0.998

Gene Details
Chromosome: 21
Transcript: ENST00000617971
Biotype: lincRNA
Gene id: ENSG00000233056
Gene Name: ERVH48-1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
889-908
0.099
1
6mer
1724-1746
0.012
1
6mer
824-838
0.006
1
RP11-363G2.4
hsa-let-7e-5p
0.998

Gene Details
Chromosome: 13
Transcript: ENST00000445646
Biotype: lincRNA
Gene id: ENSG00000229556
Gene Name: RP11-363G2.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
975-992
0.071
1
7mer
764-787
0.042
1
LINC01347
hsa-let-7e-5p
0.998

Gene Details
Chromosome: 1
Transcript: ENST00000417964
Biotype: lincRNA
Gene id: ENSG00000214837
Gene Name: LINC01347
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
424-450
0.110
2
LINC01347
hsa-let-7e-5p
0.998

Gene Details
Chromosome: 1
Transcript: ENST00000435793
Biotype: retained_intron
Gene id: ENSG00000214837
Gene Name: LINC01347
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
510-536
0.109
2
RP13-580B18.4
hsa-let-7e-5p
0.997

Gene Details
Chromosome: 7
Transcript: ENST00000624628
Biotype: lincRNA
Gene id: ENSG00000279072
Gene Name: RP13-580B18.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2568-2584
0.006
Not Conserved
8mer
6001-6022
0.006
1
8mer
4259-4280
0.006
1
8mer
19547-19570
0.006
1
8mer
1925-1947
0.005
Not Conserved
7mer
23673-23696
0.005
1
8mer+wobble
23769-23787
0.004
1
8mer+wobble
346-363
0.004
1
8mer
15344-15365
0.004
Not Conserved
8mer
17086-17107
0.004
Not Conserved
9mer
22463-22474
0.004
Not Conserved
8mer
11515-11536
0.004
Not Conserved
8mer
9677-9698
0.004
Not Conserved
8mer
13497-13518
0.003
Not Conserved
8mer
7791-7812
0.003
Not Conserved
6mer
23535-23557
0.002
1
6mer
19931-19956
0.002
1
8mer+wobble
19003-19019
0.002
1
8mer+wobble
21098-21122
0.002
1
8mer+wobble
22265-22286
0.002
1
8mer+wobble
7508-7530
0.002
Not Conserved
8mer+wobble
3976-3998
0.001
1
8mer+wobble
18645-18667
0.001
1
8mer+wobble
20338-20361
0.001
Not Conserved
8mer+wobble
3712-3735
0.001
1
8mer+wobble
14797-14820
0.001
Not Conserved
8mer+wobble
10968-10991
0.001
Not Conserved
8mer+wobble
10281-10305
0.001
1
8mer+wobble
5454-5477
0.001
Not Conserved
8mer+wobble
16539-16562
0.001
Not Conserved
8mer+wobble
7244-7267
0.001
Not Conserved
8mer+wobble
9130-9153
0.001
Not Conserved
8mer+wobble
9394-9416
0.001
Not Conserved
8mer+wobble
2222-2244
0.001
Not Conserved
8mer+wobble
1576-1598
0.001
Not Conserved
8mer+wobble
12950-12973
0.001
Not Conserved
8mer+wobble
15061-15083
0.001
Not Conserved
8mer+wobble
11232-11254
0.001
Not Conserved
8mer+wobble
16803-16825
0.001
Not Conserved
8mer+wobble
5718-5740
0.001
Not Conserved
8mer+wobble
13214-13236
0.001
Not Conserved
8mer+wobble
6557-6581
0.001
Not Conserved
8mer+wobble
15852-15876
0.001
Not Conserved
8mer+wobble
8443-8467
0.001
Not Conserved
8mer+wobble
18381-18393
0.001
Not Conserved
8mer+wobble
4767-4791
0.001
Not Conserved
8mer+wobble
14101-14125
0.001
Not Conserved
8mer+wobble
12263-12287
0.001
Not Conserved
8mer+wobble
17690-17714
0.001
Not Conserved
8mer+wobble
22233-22257
0.000
Not Conserved
XLOC_013703
hsa-let-7e-5p
0.997

Gene Details
Chromosome: chr20
Transcript: TCONS_00028028
Biotype: transcript isomorph
Gene id: XLOC_013703
Gene Name: XLOC_013703
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1079-1105
0.090
1
6mer
126-147
0.016
1
AC012499.1
hsa-let-7e-5p
0.996

Gene Details
Chromosome: 2
Transcript: ENST00000412133
Biotype: antisense
Gene id: ENSG00000229941
Gene Name: AC012499.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
584-596
0.090
2
7mer
155-173
0.012
5
RP11-583F2.7
hsa-let-7e-5p
0.996

Gene Details
Chromosome: 17
Transcript: ENST00000577423
Biotype: processed_transcript
Gene id: ENSG00000280299
Gene Name: RP11-583F2.7
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7e-5p
Sequence: ugagguaggagguuguauaguu
MirBase ID: MIMAT0000066
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
335-360
0.092
11
6mer
303-321
0.006
8
6mer
99-112
0.003
2
Funded by: