Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
chr22-38_28785274-29006793.1
hsa-miR-1-3p
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
69987-70000
0.010
2
7mer
96352-96370
0.006
2
6mer
267333-267360
0.005
2
7mer
254678-254699
0.005
7
7mer
159754-159759
0.005
2
7mer
162845-162866
0.004
6
7mer
185256-185276
0.004
2
7mer
148712-148727
0.004
3
8mer
231385-231404
0.004
1
8mer
206404-206410
0.004
Not Conserved
7mer
120457-120479
0.003
2
6mer
145702-145716
0.003
8
7mer
258781-258797
0.003
2
7mer
173487-173501
0.003
2
7mer
226444-226463
0.003
2
7mer
117401-117428
0.003
1
6mer
116499-116521
0.003
10
7mer
96854-96859
0.003
2
7mer
206747-206765
0.003
2
6mer
128711-128738
0.003
9
7mer
68053-68068
0.003
2
7mer
156214-156235
0.003
2
7mer
91745-91768
0.003
1
7mer
144968-144974
0.003
2
7mer
227636-227655
0.003
1
6mer
163523-163527
0.002
6
6mer
104433-104452
0.002
4
7mer
225711-225728
0.002
1
7mer
115116-115130
0.002
2
7mer
80069-80092
0.002
Not Conserved
6mer
53304-53324
0.002
3
7mer
63855-63880
0.002
2
6mer
19531-19550
0.002
2
7mer
232462-232481
0.002
1
6mer
27034-27058
0.002
4
6mer
57050-57069
0.002
2
6mer
125281-125300
0.002
4
6mer
19854-19870
0.002
2
6mer
146723-146728
0.002
2
6mer
13775-13798
0.002
4
6mer
204826-204849
0.002
3
6mer
254056-254071
0.002
3
6mer
245473-245492
0.002
1
6mer
179790-179805
0.002
4
6mer
45809-45827
0.002
2
6mer
107071-107085
0.002
3
6mer
70394-70419
0.002
2
6mer
155124-155139
0.002
2
7mer
210419-210424
0.002
2
6mer
67250-67264
0.002
4
6mer
92574-92594
0.002
3
6mer
113303-113311
0.002
2
6mer
200415-200432
0.002
2
6mer
3140-3165
0.002
3
6mer
175307-175325
0.002
3
7mer
137126-137148
0.002
2
6mer
180111-180126
0.002
2
6mer
159421-159434
0.002
1
6mer
129477-129491
0.002
1
6mer
102072-102095
0.002
4
6mer
114291-114313
0.002
4
6mer
227025-227047
0.002
2
7mer
122901-122919
0.002
1
6mer
193846-193868
0.002
Not Conserved
6mer
191392-191408
0.002
2
6mer
30614-30618
0.002
1
6mer
256965-256969
0.002
2
6mer
232191-232208
0.002
1
6mer
130730-130750
0.002
4
6mer
5192-5208
0.002
2
6mer
177331-177357
0.002
2
6mer
93478-93491
0.002
2
6mer
77523-77543
0.002
1
6mer
197507-197525
0.002
1
6mer
260929-260949
0.002
2
6mer
62325-62337
0.002
4
6mer
113818-113833
0.002
3
6mer
109073-109097
0.002
4
6mer
79056-79060
0.001
5
6mer
188416-188434
0.001
2
6mer
83927-83951
0.001
2
6mer
21232-21254
0.001
2
6mer
40575-40599
0.001
4
6mer
167161-167175
0.001
4
6mer
210265-210274
0.001
6
6mer
42539-42553
0.001
1
6mer
113470-113485
0.001
2
6mer
52937-52945
0.001
2
6mer
257607-257613
0.001
2
6mer
226674-226692
0.001
1
6mer
112976-112999
0.001
1
6mer
69363-69372
0.001
2
6mer
234151-234160
0.001
3
6mer
183400-183417
0.001
2
6mer
122092-122112
0.001
1
6mer
110405-110409
0.001
2
6mer
231956-231963
0.001
1
6mer
78156-78175
0.001
2
6mer
209707-209719
0.001
4
6mer
237607-237623
0.001
4
6mer
23061-23080
0.001
2
6mer
163703-163707
0.001
3
6mer
217434-217439
0.001
1
6mer
82889-82912
0.001
3
6mer
180389-180416
0.001
1
6mer
173376-173399
0.001
4
6mer
97363-97383
0.001
1
6mer
83495-83510
0.001
2
6mer
182021-182047
0.001
3
6mer
255901-255907
0.001
2
6mer
39278-39295
0.001
1
6mer
205307-205312
0.001
1
6mer
4337-4357
0.001
Not Conserved
6mer
50258-50279
0.001
1
6mer
54676-54697
0.001
1
6mer
53879-53891
0.001
2
7mer
210295-210314
0.001
3
6mer
178853-178865
0.001
1
6mer
163529-163551
0.001
8
6mer
40283-40301
0.001
1
6mer
256110-256131
0.001
1
6mer
48673-48682
0.001
1
6mer
159762-159787
0.001
2
6mer
210171-210195
0.001
2
6mer
209996-210016
0.001
1
6mer
232544-232548
0.001
1
7mer
67335-67354
0.001
1
6mer
258790-258804
0.001
1
6mer
30611-30624
0.001
2
6mer
205303-205316
0.000
1
6mer
5276-5289
0.000
Not Conserved
GNG12-AS1
hsa-miR-1-3p
1.000

Gene Details
Chromosome: 1
Transcript: ENST00000434072
Biotype: antisense
Gene id: ENSG00000232284
Gene Name: GNG12-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
428-444
0.152
9
8mer
345-364
0.050
6
7mer
214-225
0.016
4
6mer
235-249
0.011
9
XLOC_003873
hsa-miR-1-3p
1.000

Gene Details
Chromosome: chr4
Transcript: TCONS_00008418
Biotype: transcript isomorph
Gene id: XLOC_003873
Gene Name: XLOC_003873
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Ovary Normal/Primary


miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
79-100
0.170
1
RP11-810M2.2
hsa-miR-1-3p
1.000

Gene Details
Chromosome: 17
Transcript: ENST00000573371
Biotype: antisense
Gene id: ENSG00000263165
Gene Name: RP11-810M2.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
46-71
0.153
8
XLOC_013010
hsa-miR-1-3p
1.000

Gene Details
Chromosome: chr19
Transcript: TCONS_00026952
Biotype: transcript isomorph
Gene id: XLOC_013010
Gene Name: XLOC_013010
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1466-1486
0.146
1
AC005537.2
hsa-miR-1-3p
1.000

Gene Details
Chromosome: 7
Transcript: ENST00000588324
Biotype: lincRNA
Gene id: ENSG00000232006
Gene Name: AC005537.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1014-1028
0.144
2
XLOC_004128
hsa-miR-1-3p
1.000

Gene Details
Chromosome: chr4
Transcript: TCONS_00007884
Biotype: transcript isomorph
Gene id: XLOC_004128
Gene Name: XLOC_004128
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
274-296
0.143
1
RP11-554D14.8
hsa-miR-1-3p
1.000

Gene Details
Chromosome: 12
Transcript: ENST00000618339
Biotype: lincRNA
Gene id: ENSG00000274395
Gene Name: RP11-554D14.8
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
32-51
0.108
1
7mer
898-913
0.033
1
CYP4F26P
hsa-miR-1-3p
1.000

Gene Details
Chromosome: 9
Transcript: ENST00000432139
Biotype: lincRNA
Gene id: ENSG00000226562
Gene Name: CYP4F26P
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
292-298
0.138
1
RP11-932O9.10
hsa-miR-1-3p
1.000

Gene Details
Chromosome: 15
Transcript: ENST00000602684
Biotype: lincRNA
Gene id: ENSG00000269974
Gene Name: RP11-932O9.10
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
248-268
0.138
1
XLOC_010190
hsa-miR-1-3p
1.000

Gene Details
Chromosome: chr12
Transcript: TCONS_00020909
Biotype: transcript isomorph
Gene id: XLOC_010190
Gene Name: XLOC_010190
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Breast Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
20-39
0.114
1
7mer
886-901
0.024
1
XLOC_009925
hsa-miR-1-3p
1.000

Gene Details
Chromosome: chr12
Transcript: TCONS_00020607
Biotype: transcript isomorph
Gene id: XLOC_009925
Gene Name: XLOC_009925
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
- Testes Normal/Primary
- Thyroid Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
228-250
0.137
2
XLOC_009000
hsa-miR-1-3p
1.000

Gene Details
Chromosome: chr10
Transcript: TCONS_00018649
Biotype: transcript isomorph
Gene id: XLOC_009000
Gene Name: XLOC_009000
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
Fibroblasts Lung Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
68-87
0.009
1
7mer
376-403
0.008
2
7mer
1014-1033
0.008
1
7mer
136-148
0.008
1
7mer
948-960
0.007
1
7mer
880-899
0.007
1
7mer
168-187
0.006
1
7mer
238-255
0.006
1
7mer
344-356
0.006
1
7mer
32-51
0.006
Not Conserved
7mer
684-696
0.006
1
7mer
748-760
0.005
1
7mer
204-221
0.005
Not Conserved
7mer
408-420
0.005
1
7mer
780-797
0.005
Not Conserved
7mer
916-943
0.004
Not Conserved
7mer
846-863
0.004
Not Conserved
7mer
308-327
0.004
1
7mer
544-563
0.004
1
7mer
476-495
0.004
1
7mer
440-459
0.004
1
7mer
648-667
0.003
Not Conserved
7mer
580-592
0.003
Not Conserved
7mer
272-286
0.003
Not Conserved
6mer
104-116
0.003
Not Conserved
7mer
612-631
0.003
Not Conserved
7mer
512-524
0.003
Not Conserved
CASK-AS1
hsa-miR-1-3p
1.000

Gene Details
Chromosome: X
Transcript: ENST00000451126
Biotype: antisense
Gene id: ENSG00000233033
Gene Name: CASK-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
110-121
0.136
13
XLOC_011716
hsa-miR-1-3p
0.999

Gene Details
Chromosome: chr16
Transcript: TCONS_00024391
Biotype: transcript isomorph
Gene id: XLOC_011716
Gene Name: XLOC_011716
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
458-477
0.125
8
6mer
443-470
0.007
5
RP11-21B23.3
hsa-miR-1-3p
0.999

Gene Details
Chromosome: 16
Transcript: ENST00000567899
Biotype: lincRNA
Gene id: ENSG00000260573
Gene Name: RP11-21B23.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
429-448
0.123
8
6mer
414-441
0.007
5
RP5-988G17.1
hsa-miR-1-3p
0.999

Gene Details
Chromosome: 20
Transcript: ENST00000455299
Biotype: lincRNA
Gene id: ENSG00000224711
Gene Name: RP5-988G17.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
125-144
0.126
8
AC006262.5
hsa-miR-1-3p
0.999

Gene Details
Chromosome: 19
Transcript: ENST00000601263
Biotype: lincRNA
Gene id: ENSG00000268621
Gene Name: AC006262.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary


miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
231-258
0.120
1
LOC100190986
hsa-miR-1-3p
0.999

Gene Details
Chromosome: 16
Transcript: NR_024456.1
Biotype: sense
Gene id: NR_024456.1 (gene)
Gene Name: LOC100190986
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
419-425
0.119
1
AC002472.11
hsa-miR-1-3p
0.999

Gene Details
Chromosome: 22
Transcript: ENST00000450652
Biotype: antisense
Gene id: ENSG00000226872
Gene Name: AC002472.11
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
77-98
0.119
13
Funded by: