Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-106b-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
chr22-38_28785274-29006793.1
hsa-miR-106b-5p
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
175909-175927
0.019
4
9mer
89504-89519
0.013
4
8mer
14018-14035
0.010
1
8mer
165227-165239
0.010
5
8mer
220518-220543
0.010
2
8mer
10725-10745
0.009
1
8mer
107252-107269
0.008
2
8mer
52899-52910
0.008
5
8mer
178040-178056
0.007
2
8mer
225499-225516
0.007
2
8mer
251117-251133
0.007
1
7mer
50481-50500
0.006
1
7mer
16900-16922
0.006
2
7mer
133494-133512
0.006
2
7mer
193799-193819
0.006
1
9mer
256647-256667
0.005
1
8mer
199223-199247
0.005
2
7mer
92503-92525
0.005
3
8mer
52138-52155
0.005
2
7mer
917-934
0.005
2
7mer
172347-172358
0.005
3
7mer
161223-161243
0.005
1
8mer+wobble
127340-127359
0.005
2
7mer
56232-56249
0.004
2
7mer
80781-80799
0.004
2
7mer
127893-127913
0.004
1
8mer
155511-155532
0.004
2
8mer
67837-67857
0.004
2
8mer
180846-180864
0.004
2
8mer
221550-221567
0.004
2
8mer
213960-213982
0.004
3
8mer
234653-234670
0.004
2
8mer
261772-261791
0.004
1
7mer
160697-160714
0.004
4
8mer
244863-244887
0.004
1
8mer
250229-250246
0.004
1
7mer
81574-81599
0.004
7
6mer
267038-267054
0.004
1
7mer
175140-175156
0.004
3
8mer
77177-77194
0.004
2
8mer
11456-11473
0.004
2
8mer
67549-67569
0.004
2
7mer
199899-199916
0.004
2
8mer+wobble
167302-167320
0.003
2
8mer
27726-27745
0.003
1
6mer
131803-131819
0.003
8
8mer
236479-236496
0.003
2
8mer
135107-135131
0.003
2
8mer
14163-14180
0.003
2
8mer
109484-109504
0.003
2
8mer
38250-38267
0.003
2
8mer
237872-237892
0.003
2
6mer
100356-100378
0.003
8
8mer
262100-262117
0.003
2
7mer
145526-145539
0.003
1
8mer
102890-102907
0.003
2
8mer
239061-239080
0.003
2
7mer
104448-104470
0.003
3
8mer
188888-188905
0.003
2
6mer
145006-145029
0.003
8
8mer
253394-253411
0.003
2
8mer
249438-249458
0.003
1
8mer
225075-225092
0.003
2
8mer
64974-64991
0.003
2
8mer
223518-223538
0.003
2
8mer
122235-122252
0.003
2
8mer
251555-251572
0.003
1
8mer
252064-252081
0.003
2
8mer
192477-192497
0.003
1
8mer
114901-114918
0.003
2
8mer
60222-60242
0.003
2
8mer
187108-187125
0.003
1
6mer
182715-182734
0.003
8
8mer
14855-14875
0.003
1
8mer
263105-263122
0.003
1
8mer
231656-231673
0.003
1
7mer
101862-101879
0.003
2
7mer
236287-236300
0.003
1
8mer
213280-213300
0.003
1
8mer
174447-174464
0.003
1
8mer
8822-8842
0.003
1
6mer
150454-150475
0.003
6
8mer
73055-73074
0.003
1
7mer
166759-166774
0.003
2
6mer
127550-127569
0.003
3
8mer
84847-84855
0.002
3
8mer
209139-209159
0.002
2
8mer
206106-206131
0.002
1
6mer
183328-183354
0.002
5
6mer
145671-145695
0.002
9
8mer
247889-247909
0.002
1
8mer
45044-45061
0.002
1
7mer
219865-219892
0.002
2
8mer
37460-37484
0.002
Not Conserved
6mer
17535-17546
0.002
2
6mer
131046-131064
0.002
2
6mer
169331-169340
0.002
1
6mer
43071-43091
0.002
2
8mer
193332-193349
0.002
Not Conserved
6mer
197119-197137
0.002
2
6mer
131357-131375
0.002
4
6mer
254579-254600
0.002
6
6mer
166144-166167
0.002
4
7mer
121444-121464
0.002
2
8mer
177421-177441
0.002
2
7mer
23495-23517
0.002
2
6mer
116883-116887
0.002
2
8mer
181153-181170
0.002
Not Conserved
6mer
151340-151355
0.002
4
8mer
202786-202806
0.002
Not Conserved
6mer
13494-13513
0.002
2
6mer
71214-71234
0.002
2
6mer
52419-52433
0.002
5
6mer
203679-203700
0.002
1
6mer
92164-92189
0.002
4
8mer
167722-167739
0.002
2
6mer
11224-11244
0.002
2
6mer
84810-84832
0.002
4
6mer
260798-260814
0.002
2
6mer
69929-69943
0.002
2
6mer
250848-250868
0.002
1
6mer
51814-51832
0.002
4
8mer
231045-231065
0.002
1
6mer
157690-157716
0.002
2
6mer
94115-94141
0.002
6
6mer
184853-184867
0.002
2
6mer
92345-92366
0.002
2
6mer
175013-175037
0.002
1
6mer
198080-198094
0.002
1
6mer
140744-140767
0.002
2
6mer
89894-89915
0.002
2
6mer
109029-109039
0.002
2
6mer
147624-147640
0.002
3
6mer
60617-60632
0.002
3
6mer
4885-4900
0.002
2
6mer
160525-160540
0.002
1
6mer
18598-18611
0.002
2
6mer
41176-41199
0.002
2
6mer
187401-187413
0.002
4
6mer
100978-101000
0.002
3
6mer
113939-113955
0.002
2
6mer
185776-185802
0.002
3
6mer
202300-202318
0.002
Not Conserved
6mer
57316-57324
0.002
2
6mer
136113-136131
0.002
2
6mer
150806-150811
0.002
1
6mer
244007-244026
0.002
2
6mer
109797-109817
0.002
2
6mer
250004-250021
0.002
1
6mer
30049-30073
0.002
2
6mer
177317-177337
0.002
2
6mer
80076-80096
0.001
Not Conserved
6mer
126400-126416
0.001
2
6mer
30917-30934
0.001
2
6mer
179086-179103
0.001
2
6mer
173807-173824
0.001
2
6mer
153974-153999
0.001
2
6mer
175535-175557
0.001
2
6mer
194481-194494
0.001
2
8mer
250901-250921
0.001
1
6mer
61680-61700
0.001
2
6mer
23365-23379
0.001
1
6mer
152913-152934
0.001
1
6mer
48791-48810
0.001
3
6mer
157977-157998
0.001
3
6mer
182848-182871
0.001
4
6mer
228162-228174
0.001
2
6mer
154794-154815
0.001
3
6mer
5567-5585
0.001
4
6mer
195843-195863
0.001
2
8mer+mismatch
229818-229838
0.001
1
6mer
167573-167594
0.001
1
6mer
240525-240543
0.001
2
6mer
255691-255713
0.001
2
6mer
68855-68875
0.001
1
6mer
240008-240028
0.001
2
6mer
200834-200853
0.001
2
6mer
163808-163820
0.001
3
8mer
234713-234732
0.001
1
6mer
255308-255322
0.001
2
6mer
31416-31439
0.001
2
6mer
85207-85227
0.001
2
6mer
35800-35820
0.001
1
6mer
245772-245785
0.001
1
6mer
45886-45904
0.001
2
6mer
183668-183686
0.001
1
6mer
146312-146338
0.001
Not Conserved
6mer
242482-242491
0.001
1
6mer
115886-115906
0.001
2
6mer
98425-98447
0.001
1
6mer
240919-240936
0.001
2
6mer
31773-31786
0.001
Not Conserved
6mer
35333-35354
0.001
2
6mer
121083-121105
0.001
1
6mer
217110-217122
0.001
1
6mer
134405-134430
0.001
2
6mer
177823-177843
0.001
2
6mer
73377-73397
0.001
1
6mer
153372-153389
0.001
1
6mer
92551-92569
0.001
1
6mer
154894-154916
0.001
2
6mer
217222-217242
0.001
1
6mer
89921-89935
0.001
2
7mer
100428-100442
0.001
1
COX10-AS1
hsa-miR-106b-5p
1.000

Gene Details
Chromosome: 17
Transcript: ENST00000623598
Biotype: TEC
Gene id: ENSG00000236088
Gene Name: COX10-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1822-1840
0.204
1
6mer
144-163
0.004
Not Conserved
6mer
365-391
0.003
Not Conserved
TSIX
hsa-miR-106b-5p
1.000

Gene Details
Chromosome: X
Transcript: ENST00000604411
Biotype: lincRNA
Gene id: ENSG00000270641
Gene Name: TSIX
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
32817-32843
0.039
5
9mer
36149-36168
0.037
4
8mer
33134-33153
0.011
3
9mer
30784-30803
0.009
2
7mer
4835-4853
0.009
4
8mer
40-57
0.008
1
7mer
33551-33565
0.008
5
7mer
2347-2373
0.006
1
7mer
35711-35728
0.005
3
7mer
28105-28120
0.005
1
6mer
36433-36448
0.004
2
7mer
30750-30767
0.004
2
7mer
20929-20956
0.003
1
7mer
34032-34042
0.003
3
8mer
27462-27482
0.003
2
8mer
3393-3413
0.003
2
8mer
5226-5246
0.003
2
8mer
7154-7174
0.003
1
6mer
23864-23884
0.003
3
6mer
19897-19916
0.002
3
6mer
32085-32110
0.002
3
6mer
2179-2200
0.002
2
6mer
31394-31416
0.002
Not Conserved
6mer
19487-19508
0.002
2
6mer
7767-7782
0.001
1
6mer
6017-6029
0.001
2
6mer
10091-10105
0.001
Not Conserved
6mer
8128-8151
0.001
1
6mer
27892-27906
0.001
2
6mer
24342-24359
0.001
2
6mer
20458-20481
0.001
1
6mer
3817-3842
0.001
1
6mer
22858-22869
0.001
2
6mer
20017-20042
0.001
2
6mer
23898-23920
0.001
3
6mer
8145-8166
0.000
1
RP13-753N3.1
hsa-miR-106b-5p
1.000

Gene Details
Chromosome: 17
Transcript: ENST00000584157
Biotype: antisense
Gene id: ENSG00000263531
Gene Name: RP13-753N3.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
5-24
0.073
1
8mer
515-535
0.061
1
8mer
141-161
0.055
1
TTTY10
hsa-miR-106b-5p
1.000

Gene Details
Chromosome: Y
Transcript: ENST00000455084
Biotype: lincRNA
Gene id: ENSG00000229236
Gene Name: TTTY10
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
249-271
0.142
1
6mer
204-217
0.018
1
6mer
591-617
0.013
1
XLOC_000782
hsa-miR-106b-5p
1.000

Gene Details
Chromosome: chr1
Transcript: TCONS_00001452
Biotype: transcript isomorph
Gene id: XLOC_000782
Gene Name: XLOC_000782
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2280-2290
0.161
1
6mer
1033-1049
0.008
1
RP1-184J9.2
hsa-miR-106b-5p
1.000

Gene Details
Chromosome: 1
Transcript: ENST00000427154
Biotype: antisense
Gene id: ENSG00000240553
Gene Name: RP1-184J9.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
485-496
0.156
11
XLOC_010384
hsa-miR-106b-5p
1.000

Gene Details
Chromosome: chr13
Transcript: TCONS_00021786
Biotype: transcript isomorph
Gene id: XLOC_010384
Gene Name: XLOC_010384
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
606-626
0.060
5
9mer
513-534
0.058
1
7mer
1029-1049
0.012
3
6mer
406-419
0.007
5
6mer
14-31
0.007
5
PVRL3-AS1
hsa-miR-106b-5p
1.000

Gene Details
Chromosome: 3
Transcript: ENST00000467426
Biotype: antisense
Gene id: ENSG00000242242
Gene Name: PVRL3-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
602-621
0.142
7
CTD-2015H6.3
hsa-miR-106b-5p
1.000

Gene Details
Chromosome: 5
Transcript: ENST00000504300
Biotype: antisense
Gene id: ENSG00000249042
Gene Name: CTD-2015H6.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
50-69
0.126
3
8mer
418-438
0.013
2
RP11-13N13.5
hsa-miR-106b-5p
0.999

Gene Details
Chromosome: 18
Transcript: ENST00000584148
Biotype: sense_intronic
Gene id: ENSG00000264188
Gene Name: RP11-13N13.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
308-325
0.074
1
8mer
146-166
0.057
1
KCNQ1OT1
hsa-miR-106b-5p
0.999

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
34858-34879
0.014
1
8mer
38449-38466
0.011
1
8mer
422-439
0.008
2
7mer
18887-18904
0.008
2
9mer
71825-71849
0.007
1
7mer
3551-3573
0.006
1
7mer
49635-49653
0.005
2
8mer
12911-12931
0.005
2
8mer
18462-18478
0.004
2
7mer
70752-70778
0.004
Not Conserved
7mer
82195-82208
0.003
1
6mer
51719-51736
0.003
5
8mer
12149-12166
0.003
1
7mer
1582-1601
0.003
1
7mer
33395-33411
0.003
1
6mer
1283-1292
0.003
2
7mer
71147-71170
0.003
1
6mer
55121-55133
0.002
5
6mer
87689-87705
0.002
2
6mer
66986-67007
0.002
2
6mer
27365-27382
0.002
1
6mer
44239-44262
0.002
3
6mer
47048-47060
0.002
4
6mer
88674-88697
0.002
3
6mer
49061-49083
0.002
3
6mer
18523-18541
0.002
2
6mer
21876-21903
0.002
1
6mer
22524-22543
0.002
1
6mer
38713-38727
0.002
1
6mer
14120-14140
0.001
1
6mer
17823-17839
0.001
1
6mer
89348-89366
0.001
2
6mer
78737-78751
0.001
1
6mer
73170-73193
0.001
2
6mer
86894-86904
0.001
1
6mer
77778-77794
0.001
2
6mer
52228-52250
0.001
2
6mer
35619-35640
0.001
1
6mer
51356-51377
0.001
2
6mer
52214-52238
0.001
2
6mer
71134-71152
0.001
1
RP11-363E7.4
hsa-miR-106b-5p
0.999

Gene Details
Chromosome: 9
Transcript: ENST00000563205
Biotype: sense_overlapping
Gene id: ENSG00000260912
Gene Name: RP11-363E7.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1726-1749
0.113
9
6mer
103-115
0.005
2
6mer
1508-1516
0.005
3
6mer
628-647
0.003
1
RP11-374M1.2
hsa-miR-106b-5p
0.998

Gene Details
Chromosome: 9
Transcript: ENST00000612999
Biotype: retained_intron
Gene id: ENSG00000231527
Gene Name: RP11-374M1.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
154-173
0.074
2
8mer
1279-1299
0.042
1
AC005019.3
hsa-miR-106b-5p
0.998

Gene Details
Chromosome: 7
Transcript: ENST00000434321
Biotype: lincRNA
Gene id: ENSG00000224330
Gene Name: AC005019.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
30-49
0.116
4
RP11-531F16.4
hsa-miR-106b-5p
0.998

Gene Details
Chromosome: 3
Transcript: ENST00000608000
Biotype: antisense
Gene id: ENSG00000273261
Gene Name: RP11-531F16.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
100-121
0.102
4
6mer
395-415
0.006
3
6mer
345-372
0.005
6
XLOC_003276
hsa-miR-106b-5p
0.998

Gene Details
Chromosome: chr3
Transcript: TCONS_00006679
Biotype: transcript isomorph
Gene id: XLOC_003276
Gene Name: XLOC_003276
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
43-64
0.096
8
6mer
11-32
0.016
8
AC002519.8
hsa-miR-106b-5p
0.998

Gene Details
Chromosome: 16
Transcript: ENST00000570073
Biotype: sense_intronic
Gene id: ENSG00000259810
Gene Name: AC002519.8
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2060-2077
0.058
2
8mer
1140-1157
0.032
2
6mer
2778-2791
0.017
2
6mer
719-741
0.005
1
RP11-553L6.5
hsa-miR-106b-5p
0.998

Gene Details
Chromosome: 3
Transcript: ENST00000570269
Biotype: lincRNA
Gene id: ENSG00000259976
Gene Name: RP11-553L6.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
94-107
0.083
16
6mer
76-99
0.015
13
6mer
237-249
0.013
16
RP11-1151B14.1
hsa-miR-106b-5p
0.997

Gene Details
Chromosome: 18
Transcript: ENST00000622635
Biotype: lincRNA
Gene id: ENSG00000276403
Gene Name: RP11-1151B14.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1236-1260
0.067
2
9mer
607-634
0.037
3
6mer
465-482
0.003
2
Funded by: